Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, the program displays no gene is found. Here are the sample runs: RESTART: E:/HW3/HW3_4_genes.py Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found e strings. TGATGCTCTAAGGATGCGCCGTTGATT TGATGCTCTAGAGATGCGCCGTTGAATAT TGATGCGTCTAAGAGACTGCTCGCCGGTTGAATAT TGATGGCTCCTATGAGAATGGCGCCCGTTTCGAAATAT