Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts

image text in transcribed

Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, the program displays no gene is found. Here are the sample runs: RESTART: E:/HW3/HW3_4_genes.py Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found e strings. TGATGCTCTAAGGATGCGCCGTTGATT TGATGCTCTAGAGATGCGCCGTTGAATAT TGATGCGTCTAAGAGACTGCTCGCCGGTTGAATAT TGATGGCTCCTATGAGAATGGCGCCCGTTTCGAAATAT

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Current Trends In Database Technology Edbt 2006 Edbt 2006 Workshops Phd Datax Iidb Iiha Icsnw Qlqp Pim Parma And Reactivity On The Web Munich Germany March 2006 Revised Selected Papers Lncs 4254

Authors: Torsten Grust ,Hagen Hopfner ,Arantza Illarramendi ,Stefan Jablonski ,Marco Mesiti ,Sascha Muller ,Paula-Lavinia Patranjan ,Kai-Uwe Sattler ,Myra Spiliopoulou ,Jef Wijsen

2006th Edition

3540467882, 978-3540467885

More Books

Students also viewed these Databases questions

Question

The company openly shares plans and information with employees.

Answered: 1 week ago