CODE IN PYTHON

def splice_rnadna, intron_list): This function takes in a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. splice_rna() should return a protein string that results from transcribing and translating the exons of the given string. (HINT: You should use some of your previous functions. It's similar to the last part of Labo3!) Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGA GCGTGTTTCAAAGTTTGCGCCTAG" Sample intron list: ["ATCGGTCGAA", "ATCGGTCGAGCGTGT"] The returned protein string: "MVYIADKQHVASREAYGHMFKVCA