Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Sep 22, 2024

For the following DNA sequence: >promoter_X1 ATGGTTGCACGAGCTTAGTCAGCCTAGCTAGCATAGCTAGCAGCTAGCTACGC Write some python code using Biopython that will search for the pattern AYCRT in both the forward and

For the following DNA sequence:

>promoter_X1 ATGGTTGCACGAGCTTAGTCAGCCTAGCTAGCATAGCTAGCAGCTAGCTACGC

Write some python code using Biopython that will search for the pattern "AYCRT" in both the forward and reverse complement of this promoter sequence. Your code should print out the location of where the match is occurring in either case.

Step by Step Solution

There are 3 Steps involved in it

Step: 1

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Nested Relations And Complex Objects In Databases Lncs 361

Authors: Serge Abiteboul ,Patrick C. Fischer ,Hans-Jorg Schek

1st Edition

3540511717, 978-3540511717

More Books

Students also viewed these Databases questions

Question

★★★★★

Write the dissociation reaction and the corresponding Ka equilibrium expression for each of the following acids in water. a. HC2H3O2 b. Co(H2O)63+ c. CH3NH3+

Answered: 1 week ago

Question

★★★★★

Write a multithreaded C program in which thread1 accepts a user data input and assigns it to a global shared integer variable. Thread-2 calls the random number generation function to obtain a locally...

Answered: 1 week ago

Question

★★★★★

Describe how to prevent and treat choking.

Answered: 1 week ago

Question

★★★★★

A pharmaceutical company conducted a study to evaluate the effect of an allergy relief medicine; 250 patients with symptoms that included itchy eyes and a skin rash received the new drug. The results...

Answered: 1 week ago

Question

★★★★★

For the following DNA sequence: >promoter_X1 ATGGTTGCACGAGCTTAGTCAGCCTAGCTAGCATAGCTAGCAGCTAGCTACGC Write some python code using Biopython that will search for the pattern "AYCRT" in both the forward...

Answered: 1 week ago

Question

★★★★★

New lithographic equipment, acquired at a cost of 5859,200 on March 1 of Year 1 (beginning of the fiscal year), has an estimated usefu life of five years and an estimated residual value of $96,660....

Answered: 1 week ago

Question

★★★★★

1. When a member with a minority interest in an LLC acquires enough ownership interests in the LLC to hold a majority interest: a. a change of ownership occurs b. reassessment of the entire parcel of...

Answered: 1 week ago

Question

★★★★★

13) On December 31, 2023, Vivid Corporation prepared adjusting entries that included the following items: Depreciation expense: $43,400. Accrued sales revenue: $40,600. Accrued expenses: $16,800....

Answered: 1 week ago

Question

★★★★★

Accounting for Gift Cards Assume Ikeo Inc. sold $160,000 of gift cards during the last two weeks of December 2020. No gift cards were redeemed in 2020, while $144,000 of the gift cards were redeemed...

Answered: 1 week ago

Question

★★★★★

Continue Mini Case 1 (the Accounting Cycle Part 1), the following information is available for FastForward in September that may need adjustments.1 1. By the end of September, FastForward has...

Answered: 1 week ago

Question

★★★★★

A water molecule is shown below. Both hydrogen atoms are the same distance from the oxygen atom and are in the x-y plane. Choose the origin to be the center of the oxygen atom, the + x direction to...

Answered: 1 week ago

Question

★★★★★

3 If you were giving a speech to an audience armed with clickers, what kinds of questions would you ask? How might the audiences responses change the nature or style of your speech? Could you make...

Answered: 1 week ago

Question

★★★★★

A In what ways were the public lives of McCarthy and Fox similar? How were they different?

Answered: 1 week ago

Question

★★★★★

Give proper credit to sources and take responsibility for your speech?

Answered: 1 week ago

Previous Question Next Question