Answered step by step
Verified Expert Solution
Question
1 Approved Answer
Given : A DNA string of length at most 1 kbp in FASTA format. Return : The position and length of every reverse palindrome in
Given: A DNA string of length at most 1 kbp in FASTA format.
Return: The position and length of every reverse palindrome in the string having length between 4 and 12. You may return these pairs in any order.
EXAMPLE: Sample Dataset: >Rosalind_24 TCAATGCATGCGGGTCTATATGCAT
Sample Output: 4 6 5 4 6 6 7 4 17 4 18 4 20 6 21 4
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started
