Answered step by step
Verified Expert Solution
Question
00
1 Approved Answer
Given the sequence in the below FASTA sequence, find all kmers of size 2 to 4 ans answer the questions below. Kmer _ Find ATTTCTGCAACTCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAA
Given the sequence in the below FASTA sequence, find all kmers of size to ans answer the questions below. KmerFind ATTTCTGCAACTCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAA CCGCGGGCTGGGAATCTGAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCT AACTATTCCCTGTGTCTTATAGGGGCCTGCGTTATCTGCCTGTCGAACCATAGGATTCGTGTCAGC GCGC Write and return a code in a language of your choice python that returns a table that displays their counts and positions. You may use compiled packages but the bulk of the code must be your own. Please add comments explaining what each step of your program does.
Given the sequence in the below FASTA sequence, find all kmers of size to ans
answer the questions below.
KmerFind
ATTTCTGCAACTCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAA
CCGCGGGCTGGGAATCTGAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCT
AACTATTCCCTGTGTCTTATAGGGGCCTGCGTTATCTGCCTGTCGAACCATAGGATTCGTGTCAGC
GCGC
Write and return a code in a language of your choice python that returns a table that displays their counts and positions. You may use compiled packages but the bulk of the code must be your own. Please add comments explaining what each step of your program does.
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access with AI-Powered Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started