IN C++ PLEASE

Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T. For example TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA. Your goal is to compute the occurrence (expressed as a percentage) of each base and output it in the following format (including the header): Base Statistics A: 26.4 C: 44.1 G: 34.8 T: 13.6 Constraints The DNA sequence can be from 1 to 50 characters long In order to output floating point numbers with only one decimal digit, you may use %.1r .You must read the DNA sequence input from the user Example 1 13.19.1: Arrays - Ex3 LAB 0/16 dna.c Load default template... 1 #include int nain) ( 5 Type your code here. * return