In Python Programming:

(Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and dis plays all genes in the genome. If no gene is found in the input sequence, the pro gram displays no gene is found. Here are the sample runs: 12 144 Enter a genome string: TTATGTTTTAAGGATCCCCTTAGTT GGGCGT