local sequence alignment with insertion/deletion length limit, by amending the Smith-Waterman algorithm which is attached below

alphabet= {A, T, C, G} w (x, -)= -3 (gap penalty) match score=5 mismatch=-2 The program should work for any two arbitrary strings. For example, S1=ACCTGATCATTTG' S2='AGCCATATCCTTAGACTGGTAC' Please modify it so that the local alignment (ignoring the unaligned ends of both sequences) that contains no more than d indels. (use d=4 in the program) 

H(i,0) = 0, 0