Please help with Rstudio in using basic statistics about this DNA sequence and answering these questions with the txt file:

>bioinformatics_is_awesome gcctgataagcgtgaggtcggaggttcaagtcctcctcgacccaccaaaattttggggcgttagctcagctgggagagcacctgctttgcaagcagggggtcatcggttcgatcccgatacgctccaccacttcttttgcgcagcaaaagaagcgcgggtggcagtgatttgcgcagcaaatcatgagaacccgct

Please go through each step so I can understand.

A. What is the name of the sequence?

B. Length of sequence

C. Number of each nucleotide (i.e. how many As, Ts, Cs, and Gs?)

D. GC content (%)

E. GC content (%) for the 1st 100 bases

F. GC content (%) for the last 200 bases

G. Plot a bar graph showing the total of each nucleotide in the sequence. Make the bar for As- red, Ts- blue, Cs- green, and Gs- black. Don't forget to add axes and title.