Question
Please help with Rstudio in using basic statistics about this DNA sequence and answering these questions with the txt file: >bioinformatics_is_awesome gcctgataagcgtgaggtcggaggttcaagtcctcctcgacccaccaaaattttggggcgttagctcagctgggagagcacctgctttgcaagcagggggtcatcggttcgatcccgatacgctccaccacttcttttgcgcagcaaaagaagcgcgggtggcagtgatttgcgcagcaaatcatgagaacccgct Please go through
Please help with Rstudio in using basic statistics about this DNA sequence and answering these questions with the txt file:
>bioinformatics_is_awesome gcctgataagcgtgaggtcggaggttcaagtcctcctcgacccaccaaaattttggggcgttagctcagctgggagagcacctgctttgcaagcagggggtcatcggttcgatcccgatacgctccaccacttcttttgcgcagcaaaagaagcgcgggtggcagtgatttgcgcagcaaatcatgagaacccgct
Please go through each step so I can understand.
A. What is the name of the sequence?
B. Length of sequence
C. Number of each nucleotide (i.e. how many As, Ts, Cs, and Gs?)
D. GC content (%)
E. GC content (%) for the 1st 100 bases
F. GC content (%) for the last 200 bases
G. Plot a bar graph showing the total of each nucleotide in the sequence. Make the bar for As- red, Ts- blue, Cs- green, and Gs- black. Don't forget to add axes and title.
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started