Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Please write a python code to solve the code challenge. Please use the sample input and output. Please show me the code you use on

Please write a python code to solve the code challenge. Please use the sample input and output. Please show me the code you use on a python sheet, so I can know how to put it in python.

image text in transcribed
Code Challenge: Implement RandomizedMotifSearch Input: Integers k and followed by a collection of strings Dna Output: A collection BestMotifs resulting from running RandomizedMotif Search(Ona, k. 1) 1,000 times. Remember toisenseudocounts Extra Dataset Debug Datasets Sample Input: 8 5 CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG TAGTACCGAGACCGAAAGAAGTATACAGGCGT TAGATCAAGTTTCAGGTGCACGTCGGTGAACC AATCCACCAGCTCCACGTGCAATGTTGGCCTA Sample Output: TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG 2012 BR Code Challenge: Implement RandomizedMotifSearch Input: Integers k and followed by a collection of strings Dna Output: A collection BestMotifs resulting from running RandomizedMotif Search(Ona, k. 1) 1,000 times. Remember toisenseudocounts Extra Dataset Debug Datasets Sample Input: 8 5 CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG TAGTACCGAGACCGAAAGAAGTATACAGGCGT TAGATCAAGTTTCAGGTGCACGTCGGTGAACC AATCCACCAGCTCCACGTGCAATGTTGGCCTA Sample Output: TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG 2012 BR

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Database Processing Fundamentals, Design, and Implementation

Authors: David M. Kroenke, David J. Auer

14th edition

133876705, 9781292107639, 1292107634, 978-0133876703

More Books

Students also viewed these Databases questions