Answered step by step
Verified Expert Solution
Question
1 Approved Answer
Please write this in python, Glossary RNA codon table A table indicating the translation of individual RNA codons into amino acids for the purpose of
Please write this in python,
Glossary RNA codon table A table indicating the translation of individual RNA codons into amino acids for the purpose of protein creation. UUU F GUU V GUC V GUA V GUG V GCU A GCC A GCA A UUC F UUAL UUG L UCU S UCC S UCA S UCGS UAU Y UACY UAA Stop UAG Stop UGU C UGC C C UGA Stop UGG W CUU | CUC L CUAL CUGL CCU P CCCP CCA P CCG P CU H CACH CAA Q CAGO CGUR CGC R CGA R CGG R AUU I AUC I AUA I AUG M ACUT ACC T ACAT ACG T AAUN AAC N AAA K AAG K AGUS AGC S AGA R AGGR GAU D GAC D GAA E GAGE GGU G GGC G GGA G GGGG Wikipedia Found a typo? Suggest a new problem Take a tour def GC_content(dna_list): This function takes in a list of DNA strings and returns the index of the DNA string with the highest GC-content and its GC-content percentage as a tuple. The GC-content of a DNA string is the percentage of nucleotides in the string that are "C" or "G". Example: Sample input list ["CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG", "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGA AGGTCTATATCCATTTGTCAGCAGACACGC","CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCT TCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT"] * The returned tuple: (2, 60.919540) def rna2codon (rna): This function takes in a string representing an RNA sequence, and returns the corresponding amino acid string, as transcribed by this codon table. You do not need to transcribe the stop codon. (HINT: You already did this in Labo3, go open it up and figure out how to incorporate it here!) Example: Sample RNA string: "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA" * The returned protein string: "MAMAPRTEINSTRINGStep by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started