Problem 1. Assume we encode A, T, C, and G as two bit codes A:00, T:01, C:10, and G:11, respectively. Given the sequence AATCGATAAGCAAAACCGGA, build a hash table with all possibl e 3-mers from this sequence Problem 1. Assume we encode A, T, C, and G as two bit codes A:00, T:01, C:10, and G:11, respectively. Given the sequence AATCGATAAGCAAAACCGGA, build a hash table with all possibl e 3-mers from this sequence