Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Problem 2 (4 pts) The F1 & R1 primers are used to PCR amplify a DNA fragment from the template shown below. F1 Forward Primer:

image text in transcribedimage text in transcribed

Problem 2 (4 pts) The F1 & R1 primers are used to PCR amplify a DNA fragment from the template shown below. F1 Forward Primer: 5' GCCAGTAG 3' R1 Reverse Primer: 5' GGGTCC 3' 5' ATAGCCAGTAGTACCATTGATACGTGACCATACGTCGGACATAGTTGGACCCAGTACAGTTT 3' a) Indicate where the forward and reverse primers bind to the template. b) How long is the amplified PCR product (don't forget to include units)? Problem 3 (2 pts) Choose two primers that can be used to PCR-amplify the bold portion of the DNA segment shown below (no more and no less). All primer sequences are in the 5'--> 3 direction. 5'-ATGTGTGATCTAAACGTAGCCGGATACGTATACTCGCATTAGTAAACTGT-3' 3'-TACACACTAGATTTGCATCGGCCTATGCATATGAGCGTAATCATTTGACA-5' primer #1: AAATCTA primer #2: ATCTAAA primer #3: GTAATCA primer #4: TGATTAC primer #5: ACTAATG primer #6: CATTAGT primer #7: TAGATTT primer #8: TTTAGAT primer #9: ATGTGTG primer #10: GTGTGTA primer #11: TACACAC primer #12: CACACAT primer #13: AAACTGT primer #14: TGTCAAA primer #15: TTTGACA primer #16: ACAGTTT Problem 2 (4 pts) The F1 & R1 primers are used to PCR amplify a DNA fragment from the template shown below. F1 Forward Primer: 5' GCCAGTAG 3' R1 Reverse Primer: 5' GGGTCC 3' 5' ATAGCCAGTAGTACCATTGATACGTGACCATACGTCGGACATAGTTGGACCCAGTACAGTTT 3' a) Indicate where the forward and reverse primers bind to the template. b) How long is the amplified PCR product (don't forget to include units)? Problem 3 (2 pts) Choose two primers that can be used to PCR-amplify the bold portion of the DNA segment shown below (no more and no less). All primer sequences are in the 5'--> 3 direction. 5'-ATGTGTGATCTAAACGTAGCCGGATACGTATACTCGCATTAGTAAACTGT-3' 3'-TACACACTAGATTTGCATCGGCCTATGCATATGAGCGTAATCATTTGACA-5' primer #1: AAATCTA primer #2: ATCTAAA primer #3: GTAATCA primer #4: TGATTAC primer #5: ACTAATG primer #6: CATTAGT primer #7: TAGATTT primer #8: TTTAGAT primer #9: ATGTGTG primer #10: GTGTGTA primer #11: TACACAC primer #12: CACACAT primer #13: AAACTGT primer #14: TGTCAAA primer #15: TTTGACA primer #16: ACAGTTT

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image_2

Step: 3

blur-text-image_3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

More Books

Students also viewed these Finance questions