Proteins and DNA are the basic building blocks of life. A protein is a sequence of

amino acids of which there are $20$ different kinds. DNA is made up of nucleic

acids. There are four nucleic acids, abbreviated with the letters A$,$ C$,$ G$,$ and T$.$ A

sequence of three nucleic acids make up a codon $($e$.$g$.,$ AAT, GCT$,$ TAC$).$ Each

codon corresponds to one of the twenty amino acids.

You are to write a program called TranslateCodons.java $($put into the package

ds$2)$ that does the following:

$-$ Read in the file data$/$codonto$3$letteraa.txt already provided which specifies

the mapping from DNA codons to the amino acids. Using one of the symbol

table implementations in algs$4,$ build a symbol table where the key is a

three$-$letter codon $($made up of the letters A$,$ C$,$ G$,$ or T$)$ and the value is the

three$-$letter abbreviation for an amino acid $($for example, "Ala", "Leu"$).$ For

example, the codon "TTA" should have the value "Leu", the codon "TAA"

should have the value $"$Stp$".$

$-$ Read in another file data$/$smallsequences$.$txt where each line consists of a

species name $($which may include spaces$),$ a tab character, and a DNA

sequence whose length is a multiple of $3.$ For each line read in$,$ print four

lines:

$1.$ the species name

$2.$ the DNA sequence broken into three$-$letter groups $($i$.$e$.,$ codons$)$

separated by whitespaces

$3.$ the three$-$letter amino acid codes corresponding to the codons in the

DNA sequence separated by whitespaces

$4.$ a blank line

For example, if the input line is:

Ailuropoda melanoleuca ATGTTCATTAACCGATGACTGTTTTCCACCAAA

your program should print:

Ailuropoda melanoleuca

ATG TTC ATT AAC CGA TGA CTG TTT TCC ACC AAA

Met Phe Ile Asn Arg Stp Leu Phe Ser Thr Lys

Notice that it is okay to have a trailing whitespace in the second and third line

that you print out.

Reading input from file

The names for the files that you read from should be specified as two separate

arguments from the command line, where the first argument points to the

location of the file $$codonto$3$letteraa.txt$$ and the second argument points to the

location of the file containing the species names and DNA sequences. For

example, one may run your program as follows:

java ds$2.$TranslateCodons data$/$codonto$3$letteraa.txt

data$/$smallsequences$.$txt

This means that in your java code, the first filepath is stored in the variable

args$[0]$ and the second filepath is stored in the variable args$[1].$ You should

create two different objects of Algs$4.$In for reading the two files.

Do not hardcode the file path in your codes.