"TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand A) For this DNA fragment (from 5' to 3') (1 mark)? B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI (0.5 marks)? C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl (0.5 marks)? D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved (2 marks).