The biology department at UC Davis is looking for an application that can decode sequences of DNA, by locating genes and transcribing the sequence of corresponding proteins. Genes are substrings of DNA which code for proteins and carry the heritable information from our parents. Genes start with the sequence of three letters ATG, called the start codon, and end with one of the three sequences TGA, TAA, or TAG, called stop codons. The stretch of sequence between the start codon and any of the stop codons is a potential gene Each codon codes for an amino acid represented by a letter of the alphabet. There is a total of 19 amino acids. Strung together, amino acids from proteins. A substring of a DNA sequence is a translatable sequence if: it has a length that is multiple of three, it starts with a start codon and ends with a stop codon it can be translated into an amino acid sequence For example, DNA sequence AATTAAGATGGGGCTCTAAAAT contains such a translatable sequence, starting at the 8th position and of length 12 (ATGGGGCTCTAA), thus consisting of 4 codons. This sequence can be translated using a codon table into the length three amino acid sequence MGL Note that the start codon codes for amino acid M while the stop codons don't code for any amino acids On the other hand, DNA sequence AATGAATCTAGT is not a translatable sequence. Write program dna_translate.c that takes two command line arguments: an input file name, containing DNA sequences, and an output file name, in which you will store the translated, protein sequences. For each sequence, the program should identify the longest possible translatable sub sequence, if one exists, and translate it into a protein using a codon table given in the file codeoflife.txt. See example below