This is Perl language question

Break down the following problem into sub-problems. Indicate input and output data. The solution has to include at least two sub-problems in addition to input and output steps. The sub-problems should be clearly indicated and thoroughly described.

Extract the header line for all FastA sequences in a file.

Example of FastA sequence file:

>H1

AAAATTTTTTAAAAGCCCC

>G2A1

TTACCCGGAAAAAAG

>ABA2

AAAATTTTTTATAGAAAAAAAAA