Use python to answer!

oneFrame Write a function oneFrame (DNA) that starts at the 0 position of DNA codon, oneFrame should take the slice of DNA beginning with th that sequence in a list and then continue searching for the nextATG star all ORFs that it found. and searches forward in units of three looking for start codons. When it finds a start at .ATG" and ask restofoRF for the open reading frame that begins there. It should store t codon and repeat this process. Ultimately, this function returns the list of Here are some examples of oneFrame in action: >> oneFrame("CCCATGTTTTGAAAAATOCCCOGGTAAA ['ATGTTTATGCCCGGG oneF rameC "CCATOTAGAAATOCCC") I1 >>> oneFrame"ATGCCCATGGGGAAATTTTGACCC) C'ATOCCCATGGGGAAATTT' ATGGGGAAATTT