Use the table to the right and the fragment of DNA below to identify the following:

the palindromic sequence $($box it in$)$

the restriction endonuclease that cuts the DNA

where the enzyme cuts the DNA

the number of base pairs in each of the resulting fragments

$\backslash$table$[[$Palindromic sequence,$\backslash$table$[[$Name of restriction enzyme that$],[$recognizes the palindrome$]]],[$GAATTC$,$EcoRl$],[$CTTAAG$,],[$AAGCTT$,$Hindill$],[$TTCGAA$,],[$CTGCAG$,$Pst$],[$GACGTC$,]]$

CATGTCATACGGTCTGCAGCCGTACTTA $-3\text{'}$

$3\text{'}-$ GTACAGTATGCCAGACGTCGGCATGAAT $-5\text{'}$

Identify one other restriction site on the above strand $($anything but EcoRI, HindIII or Pstl$)$ by boxing it in and listing the restriction enzyme and restriction site$($there are various programs on the Web that can help you identify these.$)$ Try