Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Aug 26, 2020

What are the three components that make up a firms external environment Describe how a firm would assess each of the components?

Step by Step Solution

★★★★★

3.36 Rating (159 Votes )

There are 3 Steps involved in it

Step: 1

The first component that makes up the external environment of the firm is basically the economic sit... blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Valuation Measuring and managing the values of companies

Authors: Mckinsey, Tim Koller, Marc Goedhart, David Wessel

5th edition

978-0470424650, 9780470889930, 470424656, 470889934, 978-047042470

More Books

Students also viewed these Business Communication questions

Question

★★★★★

What are the three components required to calculate economic profit? Determine BrandCos economic profit in year 1.

Answered: 1 week ago

Question

★★★★★

What are the three components of manufacturing costs? Briefly describe them.

Answered: 1 week ago

Question

★★★★★

What are the three components of net position provided by GASB? Describe how a government assigns amounts to the classifications.

Answered: 1 week ago

Question

★★★★★

Start your VM and open a terminal window (note: you may always open more than one terminal window if desired). For this laboratory exam, we will be using the network topology shown in Figure 1....

Answered: 1 week ago

Question

★★★★★

The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...

Answered: 1 week ago

Question

★★★★★

VideoSource:NationalAssociationofStateBudgetOfficers(NASBO).(2013,May20).NASBOTheStateBudgetProcess[Videofile].Retrievedfromhttps://www.youtube.com/watch?v=dt_yubkp4HI....

Answered: 1 week ago

Question

★★★★★

Let A1, A2,, An be an arbitrary collection of n events in a sample space . Show that This is known as Bonferronis inequality. (Hint: Apply Booles inequality from the last exercise to the events Ai ,...

Answered: 1 week ago

Question

★★★★★

Banko Inc. manufactures sporting goods. The following information applies to a machine purchased on January 1, 2018: Purchase price......................................$ 70,000 Delivery...

Answered: 1 week ago

Question

★★★★★

Answered: 1 week ago

Question

★★★★★

Suppose the S&P 500 Index portfolio pays a dividend yield of 2% annually. The index currently is 3,000. The T-bill rate is 3%, and the S&P futures price for delivery in one year is $3,045. Construct...

Answered: 1 week ago

Question

★★★★★

Given the following, what is disposable income? Item Annual Amount / Value Gross employment income $ 1 0 5 , 0 0 0 Housing costs $ 2 0 , 0 0 0 Bank accounts $ 4 , 0 0 0 Car loan $ 1 8 , 5 0 0...

Answered: 1 week ago

Question

★★★★★

On October 1, Alice Rodstein started a consulting firm. The asset, liability, and stockholders' equity account balances after each of her first six transactions are shown below. Describe each of...

Answered: 1 week ago

Question

★★★★★

Prepare a Corrected Trial Balance The following trial balance for Hill Company has errors that cause it to be out of balance. Prepare a corrected version of the trial balance for Hill Company....

Answered: 1 week ago

Question

★★★★★

The following data apply to Smoot Sports Inc. for April 2011: 1. Balance per the bank on April $30, \$ 12,250$. 2. Deposits in transit not recorded by the bank, $\$ 2,100$. 3. Bank error; check...

Answered: 1 week ago

Question

★★★★★

Suppose that the domestic demand and supply for hats in a small open economy are given by. where Q denotes quantity and P denotes price. a. If the world price is 10, what is the free trade level of...

Answered: 1 week ago

Question

★★★★★

An analysis of the transactions of Pickett Shipping Services for the month of May appears below. Line 1 summarizes Pickett's accounting equation data as of May 1; lines 2-10 represent the...

Answered: 1 week ago

Question

★★★★★

Use a Linux command to go into the child directory, assuming that you are in the grandparent directory. Copy - paste the command you used:

Answered: 1 week ago

Question

★★★★★

If |62x|>9, which of the following is a possible value of x? A. 2 B. 1 C. 0 D. 4 E. 7

Answered: 1 week ago

Question

★★★★★

What are the steps involved in constructing a portfolio? Discuss potential hurdles in executing the analytic approach.

Answered: 1 week ago

Question

★★★★★

Assuming that fundamental investors ultimately set a companys share price, name two reasons why you could still expect the price to show significant volatility.

Answered: 1 week ago

Question

★★★★★

Why do executives spend so much time and effort on communicating with noise traders if intrinsic investors ultimately drive a companys share price?

Answered: 1 week ago

Question

★★★★★

Name the categories used in describing the functional distribution of income. Tell which type receives the largest share and approximately how much this is in fraction or percentage terms.

Answered: 1 week ago

Question

★★★★★

Greyhound Stables, Inc. operates several dog racing tracks throughout the United States. Since most facilities are outdoor tracks only, most of the cash receipts for Greyhound are received from April...

Answered: 1 week ago

Question

★★★★★

The statement of cash flows is the only required financial statement that is not prepared from an adjusted trial balance. What are the sources of information for preparing a statement of cash flows?...

Answered: 1 week ago

Previous Question Next Question