Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Nov 22, 2022

What is the most correct IUPAC name for 2-(1-methylbutoxy)propane? 1-methyl-1-isopropoxybutane 2-isopropoxypentane 1-methyl-4-isopropoxybutane 2-oxypentylpropane 2-(oxymethylbutyl)propane

Step by Step Solution

★★★★★

3.49 Rating (162 Votes )

There are 3 Steps involved in it

Step: 1

The detailed answer for the above question is provided below Rules for IUPAC nomenclaturo se... blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

General Chemistry

Authors: Darrell Ebbing, Steven D. Gammon

9th edition

978-0618857487, 618857486, 143904399X , 978-1439043998

More Books

Students explore these related Chemistry questions

Question

What is the most obvious evidence that lava extruded under water?

Answered: 3 weeks ago

Question

What is the most abundant chemically (or biochemically) precipitated rock?

Answered: 3 weeks ago

Question

What is the most general form of a purely radial polar-coordinate incompressible flow pattern, r = r(r, , t) and = 0, which satisfies continuity?

Answered: 3 weeks ago

Question

What is a reporting entity?

Answered: 3 weeks ago

Question

1. Explain the rules for accounting for impairment of loans under Statement of Financial Accounting Standards (FAS) No. 114, Accounting by Creditors for Impairment of a Loan. Did FCB apply these...

Answered: 3 weeks ago

Question

Discuss the issues and trade-offs of using tight evaluation versus loose evaluation procedures as a product concept moves through the planning process to the commercialization stage.

Answered: 3 weeks ago

Question

The MINITAB output given in Figure 10.15 resulted from fitting a logistic regression model to the binary response variable prostatic capsule tumor penetration (CAPSULE) and the explanatory variables...

Answered: 3 weeks ago

Question

Recording manufacturing overhead costs in T-accounts Gill Corporation manufactures model airplanes. The company purchased for $170,000 automated production equipment that can make the model parts....

Answered: 3 weeks ago

Question

please dont use chat gpt 3 3 4 .

Answered: 3 weeks ago

Question

Frank Thompson operates a small business that manufactures oversized backyard games. He runs the business as a sole proprietorship. The company uses a job order cost system using a first-in,...

Answered: 3 weeks ago

Question

Which of the following does not describe a management control system? Group of answer choices monitors a company's strategic goals implements a company's strategic goals establishes a company's...

Answered: 3 weeks ago

Question

A newly formed task force to determine how many nurses are needed on each shift meets each week. The task force performance depends on the sum of individual performance, known as [ Select ] ....

Answered: 3 weeks ago

Question

Consider a game in which two students simultaneously choose effort levels span style="font-family: CambriaMath;font-size:8pt;color:rgb(0,0,0);font-style:normal;font-variant:normal;">, span...

Answered: 3 weeks ago

Question

You own a fast food business that only serves burgers, fries, and soft drinks. Part 1: Create a process flow chart for the order process from the time the customer approaches the counter to the time...

Answered: 3 weeks ago

Question

A politician develops legislation to increase economic equity. Their opponent refutes the legislation, saying, "He is a billionaire, so how can his policy be legitimate?" What kind of misdirection...

Answered: 3 weeks ago

Question

Please read the article in the link below and answer the questions. https://kdvr.com/news/macys-typo-leads-to-1500-necklace-being-sold-for-47/ Macy's typo leads to $1,500 necklace being sold for $47...

Answered: 3 weeks ago

Question

Which of the following is considered a fixed cost in the short run? A ) Electricity used in production B ) Lease payments for factory equipment C ) Shipping charges for materials D ) Wages for hourly...

Answered: 3 weeks ago

Question

Some people argue that the internal control requirements of the Sarbanes-Oxley Act (SOX) put U.S. companies at a competitive disadvantage to companies outside the United States. Discuss the...

Answered: 3 weeks ago

Question

What is the solubility of silver oxide, Ag2O, in a solution buffered at pH 10.50? The equilibrium is Ag2O(s) + H2O(l) 2Ag+(aq) + 2OH(aq); Kc = 2.0 10-8.

Answered: 3 weeks ago

Question

Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG

Answered: 3 weeks ago

Question

The [Co(NH3)6]3+ ion has a yellow color, but when one NH3 ligand is replaced by H2O to give [Co(NH3)5(H2O)]3+, the color shifts to red. Is this shift in the expected direction? Explain.

Answered: 3 weeks ago

Question

What is the net impact on Black Lion Company's Year 2 net income as a result of this hedge of a forecasted foreign currency purchase? Assume that the raw materials are consumed and become a part of...

Answered: 3 weeks ago

Question

How does the timing of hedges of the following differ? a. Foreign-currency-denominated assets and liabilities. b. Foreign currency firm commitments. c. Forecasted foreign currency transactions.

Answered: 3 weeks ago

Question

On September 30, Year 1, the Lester Company negotiated a two-year loan of 1,000,000 markkas from a foreign bank at an interest rate of 2 percent per annum. Interest payments are made annually on...

Answered: 3 weeks ago

Previous Question Next Question