Write a function that will help the doctors find the best matching amongst the three known genomes with a sequence from the unknown bacteria.

The function must be named analyzer

The function does not return any value.

The function will take in 4 string input parameters in the order

The first string parameter corresponds to genome 1

The second string parameter corresponds to genome 2

The third string parameter corresponds to genome 3

The fourth string parameter corresponds to sequence of the unknown bacteria

Display the best matching genome amongst the three genomes:

Eg : If genome 1 is the best match, the output would be

Genome 1 is the best match

If 2 or more genomes are the best matches, then display all the best matches in seperate lines:

E.g. If genome 2 and 3 are the best matches then display the following:

Genome 2 is the best match

Genome 3 is the best match

If either of the genomes or sequence is empty, display the following output and exit the function:

Genome and sequence cannot be empty

If the three genome length does not match, display the following output and exit the function:

Genome length does not match

If the sequence length is greater than any of the genome, display the following output and exit the function:

Sequence length must be smaller than genome length

Example1: One of the genomes has the best match

genome 1	AATGTTTCACC
genome 2	GACCGACTAA
genome 3	AAGGTGCTCC
sequence	TACTA
Genome 2 is the best match.

For example:

Test	Result
//For genome 2 is best match string g1 = "TAAGGCA"; string g2 = "TACCTAC"; string g3 = "AGCCAGA"; string seq = "TCT"; analyzer(g1,g2,g3,seq);	Genome 2 is the best match.
//two of the genomes are best match string g1 = "CATCATAATTAGCACGTTGTTGGTACCTAGAGACCAACTTAC"; string g2 = "TGGAGACCCACCCGTTACTTCTGACAGACAGAAGTGAGCGAT"; string g3 = "CCTAACGTGTGGCCACGCGGGAGAAGAGGTTTACCATTCTGC"; string seq = "TCTTTTA"; analyzer(g1,g2,g3,seq);	Genome 2 is the best match. Genome 3 is the best match.

C++ only