Question
Write a program for the following scenario with sample output(IN JAVA) Scenario: (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and
Write a program for the following scenario with sample output(IN JAVA)
Scenario: (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a sub string of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, displays no gene. Here are the sample runs:
Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT
O/P: TTT
GGGCGT
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started
Machine Learning And Knowledge Discovery In Databases European Conference Ecml Pkdd 2022 Grenoble France September 19 23 2022 Proceedings Part 4 Lnai 13716
Authors: Massih-Reza Amini ,Stephane Canu ,Asja Fischer ,Tias Guns ,Petra Kralj Novak ,Grigorios Tsoumakas
1st Edition
3031264118, 978-3031264115
