Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

You have been asked to prepare a December cash budget for Ashton Company, a distributor of exercise equipment. The following information is available about the

image text in transcribed
You have been asked to prepare a December cash budget for Ashton Company, a distributor of exercise equipment. The following information is available about the company's operations: a. The cash balance on December 1 is $51,000. b. Actual sales for October and November and expected sales for December are as follows: Cash sales Sales on account $, 68,200 8I,600 $ 90,600 510,000 603,000 636,000 Sales on account are collected over a three-month period as follows: 20% collected in the month of sale, 60% collected in the month following sale, and 18% collected in the second month following sale. The remaining 2% is uncollectible. c. Purchases of inventory will total $282,000 for December. Thirty percent of a month's inventory purchases are paid during the month of purchase. The accounts payable remaining from November's inventory purchases total $170,500, all of which will be paid in December d. Selling and administrative expenses are budgeted at $471,000 for December. Of this amount, $61,100 is for depreciation. e. A new web server for the Marketing Department costing $118,500 will be purchased for cash during December, and dividends totaling $18,000 will be paid during the month. f. The company maintains a minimum cash balance of $20,000. An open line of credit is available from the company's bank to increase its cash balance as needed. Required: 1. Calculate the expected cash collections for December. 2. Calculate the expected cash disbursements for merchandise purchases for December. 3. Prepare a cash budget for December. Indicate in the financing section any borrowing that will be needed during the month. Assume that any interest will not be paid until the following month K Prev 4 of 5 Next

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Financial Accounting

Authors: Bev Vickerstaff, Parminder Johal

1st Edition

1444170414, 978-1444170412

More Books

Students also viewed these Accounting questions

Question

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-

Answered: 1 week ago