What are intranets? What are extranets? Why are intranets and extranets important to accountants?

Question:

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Core Concepts Of Accounting Information Systems

ISBN: 9780470507025

11th Edition

Authors: Nancy A. Bagranoff, Mark G. Simkin, Carolyn Strand Norman

See More Books

Question Posted: Mar 30, 2012 04:08 AM

See More Questions

Why are GAAP and GAAS important to the IT auditor?
Why are authentication and authorization important to e-commerce?
Why is it important for the clients of professional accountants to be ethical?
In a two-player, one-shot simultaneous-move game each player can choose strategy A or strategy B. If both players choose strategy A, each earns a payoff of $500. If both players choose strategy B,...
Yippee Corp. has recently organized. The company issued common shares to a lawyer who provided legal services worth $7,500 to help organize the corporation. It issued common shares to another person...
How many electrons are in the third shell of sodium, Na (atomic number 11)? (a) none (b) 1 (c) 2 (d) 3
Oral Contracts. Jason Novell, doing business as Novell Associates, hired Barbara Meade as an independent contractor in March 2007. The parties orally agreed on the terms of employment, including...
Crystal Clear Cleaning has decided that, in addition to providing cleaning services, it will sell cleaning products. Crystal Clear uses the perpetual inventory system. During December 2018, Crystal...
The following data pertains to the manufacture of cigars during October: Total labor cost variance Actual hours worked Standard rate per hour Labor rate variance $18,000 unfavorable 9,000 $16 $14,000...
The first day of work for Prevosti Farms and Sugarhouse for all employees is February 1, 2022. February 4 is the end of the first pay period and includes work completed during the week of February...
Jack Herron is an IT auditor with McGee LLP, a large national public accounting firm. His manager, Amanda McDermott, has assigned him to the Linz Company audit. The McGee financial auditors have...
What are blogs? How are they used? Who is using them?
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
If f ( x ) = - 6 x ^ 2 sin ( 3 x ) + 4 x cos ( 3 x ) what if f ' ( x ) ?
What is deformation?
What is a switched capacitor circuit?How do we design a switched capacitor circuit?
What is meant by wavelet fault diagnosis of an induction motor?
How do we design an electromagnetic relay?
Which of the steps in the accounting cycle are performed only at the end of the accounting period? lop5
The Heese Restaurant Group manufactures the bags of frozen French fries used at its franchised restaurants. Last week, Heeses purchased and used 101,000 pounds of potatoes at a price of $ 0.70 per...
Can the same two entities have more than one relationship?
On April 1 Flint Hills Travel Agency Inc. was established. These transactions were completed during the month. 1. Stockholders invested $25,000 cash in the company in exchange for common stock. 2....
Diana Kuhlmann started her own consulting firm, Kuhlmann Consulting Inc., on May 1, 2010. The following transactions occurred during the month of May. May 1 Stockholders invested $15,000 cash in the...
Dick Reber created a corporation providing legal services, Dick Reber Inc., on July 1, 2010. On July 31 the balance sheet showed: Cash $4,000; Accounts Receivable $2,500; Supplies $500; Office...
why would an auditor want to complete dual-purpose tests? what procedure can be put into place to help prevent fraud? List 4 procedures.
Based on the following information, calculate sustainable growth rate for Groot, Inc.: Profit margin= 7.1% Total asset turnover = 1.90 Total debt ratio = .45 Payout ratio = 20% What is the ROA here?
Consider the following: a call option on a stock has strike price $100, premium of $5 and the current price of the underlying stock is $100. If you buy the call option today, what is your holding...

What are intranets? What are extranets? Why are intranets and extranets important to accountants?

Question:

Step by Step Answer:

An intranet is an internal network created by an organization for the benefit of its employ...View the full answer

Core Concepts Of Accounting Information Systems

Students also viewed these Accounting questions