A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called

Question:

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2)
AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT
(a) Identify the DNA sequence that encodes each peptide.
(b) Determine the amino acid sequence of each peptide.
(c) In a mutant viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.