Describe how nucleotide substitutions at different positions in codons affect the characteristics of the encoded amino acids?
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 66% (12 reviews)
a Changes in the third position of a codon infrequently ch...View the full answer
Answered By
Gauri Hendre
I worked as EI educator for Eduphy India YT channel. I gave online tutorials to the students who were living in the villages and wanted to study much more and were preparing for NEET, TET. I gave tutions for topics in Biotechnology. I am currently working as a tutor on course hero for the biochemistry, microbiology, biology, cell biology, genetics subjects. I worked as a project intern in BAIF where did analysis on diseases mainly genetic disorders in the bovine. I worked as a trainee in serum institute of India and Vasantdada sugar institute. I am working as a writer on Quora partner program from 2019. I writing on the topics on social health issues including current COVID-19 pandemic, different concepts in science discipline. I learned foreign languages such as german and french upto A1 level. I attended different conferences in the science discipline and did trainings in cognitive skills and personality development skills from Lila Poonawalla foundation. I have been the member of Lila poonawalla foundation since 2017. Even I acquired the skills like Excel spreadsheet, MS Office, MS Powerpoint and Data entry.
5.00+
4+ Reviews
10+ Question Solved
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Question Posted:
Students also viewed these Medical Sciences questions
-
The following apparatus can be used to measure atomic and molecular speed. Suppose that a beam of metal atoms is directed at a rotating cylinder in a vacuum. A small opening in the cylinder allows...
-
A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The following number of nucleotide differences were obtained: Construct a phylogenetic tree that...
-
Let's suppose a DNA mutation changes the consensus sequence at the -35 location in a way that inhibits factor binding. Explain how a mutation could inhibit the binding of factor to the DNA. Look at...
-
A thermocouple Type K is calibrated in lab condition at 50% relative humidity (RH) prior to outdoor operation. After 12-month in outdoor installation, the thermocouple is again tested at 75% RH. Both...
-
Florences daughter, Eunice, needs $5,000 to start a business. Florence agrees to give her the money but will have to sell some securities to raise that much cash. Florence has 1,200 shares of Tom...
-
From the following trial balance of Halls Cleaners, prepare the following: Income Statement Statement of Owners Equity Balance Sheet LO.1 Cash Equipment Accounts Payable J. Hall, Capital J. Hall,...
-
For the network in Figure 6.19. the router has two ARP modules, each with its own ARP table. Is it possible that the same MAC address appears in both tables? Figure 6.19
-
The costs of rework are always charged to the specific jobs in which the defects were originally discovered. Do you agree? Explain.
-
Bianca Bicycle Company manufactures mountain bikes with a variable cost of $200. The cost per unit remained the same in the current year as in the previous year. The bicycles sell for $350 each....
-
Construct a calendar spread using the August and October 170 calls that will profit from high volatility. Close the position on August 1. Use the spreadsheet to find the profits for the possible...
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
What two reactions are carried out by aminoacyl-tRNA synthetases?
-
Suppose Douglas and Ziffel have properties that adjoin the farm of Mr. Haney. The current zoning law permits Haney to use the farm for any purpose. Haney has decided to raise pigs (the best use of...
-
The employee.class.php file contains an abstract, base class named Employee . One of the attributes of the class is an object of Person . This demonstrates one of the three relationship types among...
-
A direct shear test is performed on a saturated specimen of loose sand. A normal stress equal to 100 kPa is applied and a maximum shear stress of 75 kPa is measured in the shear test. Determine the...
-
How does budgeting help managers? Budgeting helps managers determine if their goals are ethical and achievable. Budgeting helps managers determine if their goals are reasonable and achievable....
-
If the 230-lb block is released from rest when the spring is unstretched, determine the velocity of the block after it has descended 5ft . The drum has a weight of 70lb and a radius of gyration of...
-
A B C D E F 1 Frequency : Monthly 2 Loan Amount: 150000.00 3 Interest Rate: 7.25% 4 Term(years): 30.00 5 No. of payments in a year: 12 time(s) 6 Periodic Rate: 0.60% =C3/C5 7 Total number of payment:...
-
The 2000 census reported that 66.4% of the households in Alaska were homeowners, and the remainder were renters. During the next decade, 37.2% of the homeowners became renters, and the rest continued...
-
What is a manufacturing system?
-
In what naturally occurring nucleic acids would you expect to find A-form helices, B-form helices, Z-form helices, nucleosomes, and circular DNA?
-
What are the two principal opposing views regarding the patenting of genes?
-
What two genes are at the heart of a current lawsuit and what is their importance?
-
Based on the regression output (below), would you purchase this actively managed fund with a fee of 45bps ? Answer yes or no and one sentence to explain why.
-
What is the yield to maturity on a 10-year, 9% annual coupon, $1,000 par value bond that sells for $967.00? That sells for $1,206.10?
-
1)Prepare the journal entry to record Tamas Companys issuance of 6,500 shares of $100 par value, 9% cumulative preferred stock for $105 cash per share. 2. Assuming the facts in part 1, if Tamas...
Study smarter with the SolutionInn App