Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms

Question:

Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

In mice, the gene that encodes the enzyme inosine triphosphatase is 12 mu from the gene that encodes the enzyme ornithine decarboxylase. Suppose you have identified a strain of mice homozygous for a...
Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...
Sec18 is a yeast gene that encodes NSF. It is a class C mutant in the yeast secretory pathway. What is the mechanistic role of NSF in membrane trafficking? As indicated by its class C phenotype, why...
Define variable. Also discuss variable initialization.
Leineia owns 1,000 shares of Serous Corporation common stock. She paid $26 per share several years ago. On December 31 of the current year, Serous distributes a $5 per share cash dividend. It reports...
What is the difference between remedies at law and remedies in equity? LO4
From the definition of the DFT one can obtain a matrix equation X = Fx. (a)Suppose that N = 2 and x[n] = 1 for n = 0, 1, express the DFT as a matrix equation. (b)Check if the matrix Fin your...
The financial statements of Tootsie Roll Industries are presented in Appendix A. Instructions Answer the following questions. (a) What was the amount of net cash provided by operating activities for...
Several years after reengineering its production process, Zeke Corporation hired a new controller, Mandy Miller. (Click the icon to view additional information.) The number of parts is now a feasible...
The following are information from the books of Kwek-Kwek Malls and Tickets Company as of December 31, 2021: Signing of employment contract by a new employee on April 1, 2021. Her salary is P25,000...
Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about 65 bp. What is the reason for this minimum intron size?
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
Dominion Mobile Incorporated provides cell phone services. The company conducts a special sales campaign in which new subscribers will get a high- end cell phone for only $ 100 if they sign a 36-...
1. Define Image? 2. What is Dynamic Range? 3. Define Brightness? 4. What do you mean by Gray level? 5. What do you mean by Color model? 7. List the hardware oriented color models 8. What is Hue and...
11. Define Resolutions 12. What is meant by pixel? 13. Define Digital image 14. What are the steps involved in DIP? 15. What is recognition and Interpretation?
16. Specify the elements of DIP system 17. List the categories of digital storage 18. What are the types of light receptors? 19. Differentiate photopic and scotopic vision Photopic vision Scotopic...
21. Define subjective brightness and brightness adaptation 22. Define weber ratio 23. What is meant by machband effect? Machband effect means the intensity of the stripes is constant. Therefore it...
26. Define sampling and quantization 27. Find the number of bits required to store a 256 X 256 image with 32 gray levels 28. Write the expression to find the number of bits to store a digital image?...
In Problems 4148, discuss the validity of each statement. If the statement is always true, explain why. If not, give a counterexample. If a Markov chain has exactly three states, one absorbing and...
1-Stern observed all of the following results EXCEPT _______ in his experiment. A-one of the recombinant phenotypes was associated with an X chromosome of normal length B-the number of car, B+ male...
An amino acid mixture consisting of lysine, leucine, and glutamic acid is to be separated by ion-exchange chromatography, using a cation-exchange resin at pH 3.5, with the eluting buffer at the same...
What is meant by salting out? How does it work?
Would you use a pH meter to monitor the progress of the reaction described in Question 14? Why or why not?
Practice Problem 1 The stockholders equity accounts of Bramble Corp. on January 1, 2017, were as follows. Preferred Stock (6%, $100 par noncumulative, 4,400 shares authorized) $264,000 Common Stock...
JVCU Which of the following is considered cash for financial reporting purposes? 1 JVCU Which of the following is considered cash for financial reporting purposes? 1
Required information The Foundational 15 [LO8-2, LO8-3, LO8-4, LO8-5, LO8-7, LO8-9, L08-10) (The following information applies to the questions displayed below.) Morganton Company makes one product...

Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms

Question:

Step by Step Answer:

Alternative mRNA splicing can generate different forms of th...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions