Indicate the 10 region, the 35 region, and the initiating nucleotide on the sense strand of the E coli tRNATyr promoter shown below 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5...

The top strand is the sense strand Its TATGAT segmen ...

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the

Question:

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

Shown is a representation of a DNA molecule being transcribed? a. Identify every 3² end and every 5² end in the picture. b. Identify the template strand. c. Te non template strand is also...
The following DNA sequence occurs in a bacterium (the promoter sequence is located to the left but is not shown). 5-CAATCATGGACTGCCATGCTTCATATGAATAGTTGACAT-3...
Most humans are infected with herpes simplex virus-1 (HSV-1), the causative agent of cold sores. The HSV-1 genome comprises about I 00 genes, most of which are expressed in infected host cells at the...
Show that 1. Every differentiable concave function is pseudoconcave. 2. Every pseudoconcave function is quasiconcave
Lynn bought 100 shares of Filidelphia Corporation stock for $10,000 three years ago. On December 24, she sells 50 shares for $4,000. She plans to buy 100 more shares of Filidelphia stock for $7,000...
What is a precedent? When might a court depart from precedent? LO3
Delete
Diana Capriati, a Canadian resident for income tax purposes, has the following income for 2010 and 2011: REQUIRED Based upon the information provided, determine the maximum RRSP contribution that...
Question AZ The son of a portion of Red Seed for the past two years and company's most recent comment se bo statement of comprehensive income for the year to 31 December 2020 000 Sales 0566 Costosas...
In a Mundell-Fleming model, discuss whether a situation where the current account is in continual deficit matched by a capital account surplus constitutes external equilibrium. (b) What is exchange...
Draw a diagram, including exons and introns, of a gene that encodes both membrane-bound and soluble forms of a protein. Explain how one gene can code for two different forms of a protein.
Why does promoter efficiency tend to decrease with the number of G C base pairs in the - 10 region of a prokaryotic gene?
What should the company do to continue to grow in market value, market share, sales, and revenues?
31. What is meant by path? 32. Give the formula for calculating D4 and D8 distance. 33. What is geometric transformation? 34. What is image translation and scaling? 35. Define the term Luminance
1. Explain Brightness adaptation and Discrimination 2.Explain sampling and quantization:
3. Explain about Mach band effect? 4. Explain color image fundamentals. 5. Explain CMY model.
1. Describe the fundamental steps in image processing? 2. Explain the basic Elements of digital image processing:
3. Explain the Structure of the Human eye 4. Explain the RGB model
In Problems 4148, discuss the validity of each statement. If the statement is always true, explain why. If not, give a counterexample. If a Markov chain has an absorbing state, then it is an...
Before the latest financial crisis and recession, when was the largest recession of the past 50 years, and what was the cumulative loss in output over the course of the slowdown?
Trans-2-Butene does not exhibit a signal in the double bond region of the spectrum (16001850 cm -1 ); however, IR spectroscopy is still helpful in identifying the presence of the double bond....
As explained previously, the concentration of an alcohol can be selected such that both a broad signal and a narrow signal appear simultaneously. In such cases, the broad signal is always to the...
For each of the following IR spectra, identify whether it is consistent with the structure of an alcohol, a carboxylic acid, or neither. a. b. c. d. e. f. 100- 80- 60- 40 20- 0. 2000 4000 3500 3000...
Old MathJax webview i need Compute key financial ratios all financial ratios are required B D 2020 2019 9,169 118,378 18,423 1,839 10,244 10,748 1,648 3,963 11,048 185,460 8,822 97,719 17,417 731...
L> Moving to another question will save this response Question 1 Which of the following statements is true? o When corporate governance is strong managers may demand excessive pay O When corporate...
Document Malings Review View W Design Layout References ody - 12 - A A A A U. XX A. AD Aalto ABECEDE A AaBbc Acid 2) The Duranceau company has great difficulty controlling its indirect manufacturing...

Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the

Question:

5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5

Step by Step Answer:

The top strand is the sense strand Its TATGAT segmen...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions