Why does promoter efficiency tend to decrease with the number of G C base pairs in

Question:

Why does promoter efficiency tend to decrease with the number of G ∙ C base pairs in the - 10 region of a prokaryotic gene?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals of biochemistry Life at the Molecular Level

ISBN: 978-0470547847

4th edition

Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt

See More Books

Question Posted: Apr 30, 2016 02:56 PM

See More Questions

Show the ideal Rankine cycle with three stages of reheating on a T-s diagram; assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
Show the ideal Rankine cycle with three stages of reheating on a T-s diagram. Assume the turbine inlet temperature is the same for all stages. How does the cycle efficiency vary with the number of...
Does a power plant that has a higher thermal efficiency necessarily have a higher second-law efficiency than one with a lower thermal efficiency? Explain.
In Exercises 1-2, the augmented matrix of a linear system has been reduced by row operations to the form shown. In each case, continue the appropriate row operations and describe the solution set of...
On November 14, 2011, Noel sells 2,000 shares of Marker, Inc., stock for $6,000. He had purchased the stock two years earlier for $10,000. Because the price of the stock continued to drop, Noel...
John Tobey, a retired army officer, opened Tobeys Catering Service. As his accountant, analyze the transactions and present the following informa tion in proper form: a. The analysis of the...
Based on the illustration of an iPhone shown in Figure 2.4, draw a system model for an iPhone. Figure 2.4
In 1999, Andreas Halvorsen, David Ott, and Brian Olson formed a hedge fund, Viking Global Investors LLC. The LLC's written agreement provided that the three founders would operate Viking, and divide...
Leaf wants to file a lawsuit against the Department challenging his termination. What would a court most likely rule? Multiple Choice For the Department because it did not violate the First Amendment...
When can the centerlines of the streets in a city be painted without traveling a street more than once? (Assume that all the streets are two-way streets.)
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
Explain why inserting 5 bp of DNA at the -50 position of a eukaryotic gene decreases the rate of RNA polymerase II transcription initiation to a greater extent than inserting 10 bp at the same site.
You are testing H 0 : = 10 against H a : 10 based on an SRS of 15 observations from a Normal population. What values of the t statistic are statistically significant at the = 0.005 level? a. t...
5.Descibe the HSI color image model 6. Describe the basic relationship between the pixels
1. What is the need for transform? 2. What is Image Transform? 3. What are the applications of transform? 4. Give the Conditions for perfect transform . 5. What are the properties of unitary...
6. Define Fourier transform pair 7. Define Fourier spectrum and spectral density 8. Give the relation for 1-D discrete Fourier transform pair 9. Specify the properties of 2D Fourier transform. 10....
16. What is wrap around error? 17. Give the formula for correlation of 1D continuous function. 18. What are the properties of Haar transform. 19. What are the Properties of Slant transform 20....
21. Define fast Walsh transform. 22. Give the relation for 1-D DCT. 23. Write slant transform matrix SN. 24. Define Haar transform. 25. Define K-L transform. 26. Give the equation for singular value...
Problems 916 refer to the following transition matrix: In Problems 912, find S 1 for the indicated initial-state matrix S0 and interpret with a tree diagram. S o = [1 0] P= A A 1.8 1.4 B .2 .6
(8%) Problem 6: A student attaches a f= 3.5 kHz oscillator to one end of a metal rail of length L = 25 m. The student turns on the oscillator and uses a piezoelectric gauge at the other end to...
For an enzyme that displays MichaelisMenten kinetics, what is the reaction velocity, V (as a percentage of V max ), observed at the following values? (a) [S] = K M (b) [S] = 0.5K M (c) [S] = 0.1K M...
Determine the values of KM and Vmax for the de-carboxylation of a -keto acid given the following data. Substrate Concentration (mol L1) Velocity (mM min-1) 2.500.................. 0.588...
The kinetic data in the following table were obtained for the reaction of carbon dioxide and water to produce bicarbonate and hydrogen ion catalyzed by carbonic anhydrase: CO2 + H2O HCO-3 + H+ [H....
Each week you must submit an annotated bibliography. Entries of current events relating to the economic concepts and the impact on the company or the industry of your company. You must use acceptable...
Fluffy Toys Ltd produces stuffed toys and provided you with the following information for the month ended August 2020 Opening WIP Units 5,393 units Units Started and Completed 24,731 units Closing...
Part A Equipment 1,035,328 is incorrect Installation 44,672 is incorrect Anything boxed in red is incorrect sents 043/1 Question 9 View Policies Show Attempt History Current Attempt in Progress...

Why does promoter efficiency tend to decrease with the number of G C base pairs in

Question:

Step by Step Answer:

G C base pairs are more stable than A ...View the full answer

Fundamentals of biochemistry Life at the Molecular Level

Students also viewed these Medical Sciences questions