Why is occurrence a high-risk assertion for revenue?
Question:
Why is occurrence a high-risk assertion for revenue?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 66% (6 reviews)
In general this is an assertion that has a high ris...View the full answer
Answered By
Ashington Waweru
I am a lecturer, research writer and also a qualified financial analyst and accountant. I am qualified and articulate in many disciplines including English, Accounting, Finance, Quantitative spreadsheet analysis, Economics, and Statistics. I am an expert with sixteen years of experience in online industry-related work. I have a master's in business administration and a bachelor’s degree in education, accounting, and economics options.
I am a writer and proofreading expert with sixteen years of experience in online writing, proofreading, and text editing. I have vast knowledge and experience in writing techniques and styles such as APA, ASA, MLA, Chicago, Turabian, IEEE, and many others.
I am also an online blogger and research writer with sixteen years of writing and proofreading articles and reports. I have written many scripts and articles for blogs, and I also specialize in search engine
I have sixteen years of experience in Excel data entry, Excel data analysis, R-studio quantitative analysis, SPSS quantitative analysis, research writing, and proofreading articles and reports. I will deliver the highest quality online and offline Excel, R, SPSS, and other spreadsheet solutions within your operational deadlines. I have also compiled many original Excel quantitative and text spreadsheets which solve client’s problems in my research writing career.
I have extensive enterprise resource planning accounting, financial modeling, financial reporting, and company analysis: customer relationship management, enterprise resource planning, financial accounting projects, and corporate finance.
I am articulate in psychology, engineering, nursing, counseling, project management, accounting, finance, quantitative spreadsheet analysis, statistical and economic analysis, among many other industry fields and academic disciplines. I work to solve problems and provide accurate and credible solutions and research reports in all industries in the global economy.
I have taught and conducted masters and Ph.D. thesis research for specialists in Quantitative finance, Financial Accounting, Actuarial science, Macroeconomics, Microeconomics, Risk Management, Managerial Economics, Engineering Economics, Financial economics, Taxation and many other disciplines including water engineering, psychology, e-commerce, mechanical engineering, leadership and many others.
I have developed many courses on online websites like Teachable and Thinkific. I also developed an accounting reporting automation software project for Utafiti sacco located at ILRI Uthiru Kenya when I was working there in year 2001.
I am a mature, self-motivated worker who delivers high-quality, on-time reports which solve client’s problems accurately.
I have written many academic and professional industry research papers and tutored many clients from college to university undergraduate, master's and Ph.D. students, and corporate professionals. I anticipate your hiring me.
I know I will deliver the highest quality work you will find anywhere to award me your project work. Please note that I am looking for a long-term work relationship with you. I look forward to you delivering the best service to you.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Auditing The Art and Science of Assurance Engagements
ISBN: 978-0134613116
14th Canadian edition
Authors: Alvin A. Arens, Randal J. Elder, Mark S. Beasley, Joanne C. Jones
Question Posted:
Students also viewed these Business questions
-
Why is valuation a high-risk assertion for accounts receivable?
-
MULTIPLE-CHOICE QUESTIONS 1. Which of the following statements is true regarding assertions in the revenue cycle? a. It is typical that all five assertions for revenue are equally important. b. If a...
-
a. Analysis and evaluation: Evaluate the effectiveness of the CIRI?s control environment. You may evaluate each individual component of the control environment but then develop an overall conclusion...
-
An employee received the following benefits: regular compensation income, net of P25,000 SSS, PHIC & HDMF employee share - P850,000; 13th month pay - P120,000; De minimis benefits within their limits...
-
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
-
Read the letter and look for persuasive appeals in Buffet's letter. -select five sentences that show pathos, logos, or ethos. -Describe the analysis of your appeal. Example: Example 1 : From the...
-
Cherokee Wood Products Company prepared the following factory overhead cost budget for the Press Department for August of the current year, during which it expected to require 6,000 hours of...
-
The following provides a brief description of the computerized payroll system used by Merriman in its biweekly processing of payroll for its employees. 1. Employees automatically record their...
-
Use the following information to answer the next five questions: Consider a property with the following pro forma operating statement: PGI$1,200,000- V&C60,000EGI1,140,000- OE456,000NOI684,000 The...
-
ABC Airlines first class cabins have 10 seats in each plane. ABCs overbooking policy is to sell up to 11 first class tickets, since cancellations and no-shows are always possible (and indeed are...
-
Jeff Jacobs is a junior accountant with the public accounting firm of Maxwell and King LLP. Jeff was assigned to do the audit of Astor Electronics Inc. The in-charge auditor informed Jeff that, based...
-
Why is accounts receivable often an important account to audit?
-
Consider a multinomial experiment. This means the following: 1. The trials are independent and repeated under identical conditions. 2. The outcomes of each trial falls into exactly one of k 2...
-
What increases FCF in a given year? List different ways a manager can increase its company's free cash flow in a given year. Is increasing current year FCF always a good idea? Why or why not?
-
A car suffers from 12% annual depreciation. If the initial value is $40,000, find the value after 4 years. Hint: Depreciation means inflation (losing money). Evaluate (2-)-. Simplify (2x). Show that...
-
Let G = (V, E) be an undirected graph. For any subset A, BCV, let C(A, B) denote the set of edges between A and B, i.e., C(A, B) = {e EE e connects some vertex in A and some vertex in B}. Note that,...
-
iversification at Ratcliffe Investments What's the current situation? Sports investors around the world have reaped unprecedented returns in recent years. In the National Basketball Association...
-
What percentage of your gross salary does the Consumer Financial Protection Bureau suggest your student loan payment be in order to be affordable and limit your risk of delinquency and default?
-
1. Describe the EIA's forecast for the price of gasoline, coal, or natural gas (you can pick just one). 2. Describe one factor that is shifting the demand curve. Does this factor shift the demand...
-
A business had revenues of $280,000 and operating expenses of $315,000. Did the business (a) Incur a net loss (b) Realize net income?
-
Explain why existence is a relevant assertion for fixed assets. How does identifying relevant assertions affect audit objectives and evidence accumulation?
-
Identify the management assertion and presentation and disclosure-related audit objective for the specific presentation and disclosure-related audit objective: Read the fixed asset footnote...
-
Identify the eight phases of the audit. What is the relationship of the eight phases to the objective of the audit of financial statements?
-
Determine whether the events are independent. In a local election, 50.2% of those aged under 40 and 46.1% of those aged over 40 vote in favor of a certain ballot measure. Are age and position on the...
-
a 6000 seat theater has tickets for sale at $25 and $40
-
You plan to buy some property in Florida 9 years from today. To do this, you estimate that you will need $30,000 at that time. You would like to accumulate these funds by making equal annual deposits...
Study smarter with the SolutionInn App