In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How

Question:

In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How has it been eliminated?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Biochemistry

ISBN: 9781305961135

9th Edition

Authors: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

See More Books

Question Posted: Dec 16, 2023 06:35 AM

See More Questions

Is marketing practice little more than 'telling and selling', while marketing science is really just a matter of carrying out experiments, tests, surveys and other research to help organisations sell...
Managing Scope Changes Case Study Scope changes on a project can occur regardless of how well the project is planned or executed. Scope changes can be the result of something that was omitted during...
The Gode family arrived from the UK in 1862 to the Manly, Tingalpa and Wynnum area in Brisbane. They started developing farming and property businesses and some of the family went into law. Another...
Differentiate implicitly to find 2x + 5xy + 5y +16y - 8 = 0; dy dx . Then find the slope of the curve at the given point. (-2,0)
As sales manager, Magic Johnson was given the following static budget report for selling expenses in the Clothing Department of Lakers Company for the month of October. As a result of this budget...
Evaluate the series. (2+1) (2i i=3
If you had to choose a word to describe Chinese culture, what would that word be? Read the case study and answer the questions below. Pulling out all the stops A Canadian packaging company wished to...
Roscoe contributes a personal use asset with an adjusted basis of $15,000 and a fair market value of $28,000 on the contribution date. Determine if any gain or loss is recognized and the basis under...
need the balance sheet done Question 5 U15 SPLISH FASHION CENTER TRIAL BALANCE NOVEMBER 30, 2020 Debit Credit Cash $33.770 Accounts Receivable 37,390 Inventory 48,690 9.190 Supplies Equipment...
Immature rats are fed all the essential amino acids but one. Six hours later they are fed the missing amino acid. The rats fail to grow. Explain this observation.
It has been suggested that limits be put on the dose in vitamin A supplements sold in stores. What is a possible reason for this limitation?
Does the average length of time to earn a doctorate differ from one field to another? Independent random samples from large graduate schools gave the following averages for length of registered time...
From the perspective of organizational structure, design, and control, what have gone wrong at PNB? What factors have contributed to its current state of disarray? What should be done next to help...
Your goal is to advise the President on domestic economic policy. Role You are the chair of the Council of Economic Advisors (CEA) Audience Your audience is the President of the United States....
omework quiz 2.1 #1 stem plot The miles per gallon rating for 30 cars are shown below (lowest to highest). 19, 19, 19, 20, 21, 21, 25, 25, 25, 26, 26, 28, 29, 31, 31, 32, 32, 33, 34, 35, 36, 37, 37,...
Your answers are saved automatically. Question Completion Status: QUESTION 1 13 points Save Answer Library A computer memory manufacturer specifies that its memory chip stores data incorrectly an...
Analyze the possible reasons for and responses to Chung's request for a private office. What factors might impact Leary's decision? Identify at least two challenges and dilemmas in managing...
Use results in Sec. 5 to show that when z2 and z3 are nonzero, (a) (b) Z2Zg )-72. 243 2 73 2.1 223l3l
Using the information presented in Problem 13.4B, prepare a partial statement of cash flows for the current year, showing the computation of net cash flows from operating activities using the...
Chaperones are generally thought to facilitate protein folding. What additional functions do mitochondrial chaperones perform?
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
thumbs up if correct A stock paying no dividends is priced at $154. Over the next 3-months you expect the stock torpeither be up 10% or down 10%. The risk-free rate is 1% per annum compounded...
Question 17 2 pts Activities between affiliated entities, such as a company and its management, must be disclosed in the financial statements of a corporation as O significant relationships O segment...
Marchetti Company, a U.S.-based importer of wines and spirits, placed an order with a French supplier for 1,000 cases of wine at a price of 200 euros per case. The total purchase price is 200,000...

In the early 20th century, goiter was relatively common in the Midwest. Why was this so? How

Question:

Step by Step Answer:

Low levels of iodine in the diet often ...View the full answer

Biochemistry

Students also viewed these Sciences questions