A population has mean = 30 and standard deviation = 6. a. Find the z-score

Question:

A population has mean μ = 30 and standard deviation σ = 6.

a. Find the z-score for a population value of 21.

b. Find the z-score for a population value of 42.

c. What number has a z-score of 0.5?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Elementary Statistics

ISBN: 9781259969454

3rd Edition

Authors: William Navidi, Barry Monk

See More Books

Question Posted: May 03, 2024 04:02 AM

See More Questions

Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...
A Question 2 A steel beam extending beyond is upheld at points B and D, as depicted in Figure Q2(a). The beam's cross-sectional area is illustrated in Figure Q2(b). Answer the following questions: i....
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Given an array, Arr[] of integer numbers have size N. The task is to find out single or consecutive numbers from Arr[] with 0 sum. When found, print "1" otherwise "0". Example-1: Input: 4 (6,-2,3,-1)...
Describe the types of assets that are typically included under the heading "cash and cash equivalents" on the balance sheet. What is a "cash equivalent"?
Discuss the treatment of intercompany profit earned prior to the parent-subsidiary affiliation. LO5
Fill in the outline projected statement of financial position for Designer Dresses Ltd as at 30 June using the information contained in Example 2.1and in the answers to Activities 2.3and
1. What facts did Hartland rely on to assert the anticipatory repudiation of the contract? 2. What is the measure of damages for a breach of a construction contract? Calculate what is owed Hartland...
Use the information in each of the following separate cases to calculate the unknown amount. a . Corentine Company had $ 1 6 1 , 0 0 0 of accounts payable on September 3 0 and $ 1 3 7 , 0 0 0 on...
According to theWall Street Journal, the maximum distance from check-in to the gate at top U.S. airports has a mean of 0.79 miles with a standard deviation of 0.42 miles. a. The maximum distance at...
A population has mean = 10 and standard deviation = 4. a. Find the z-score for a population value of 14. b. Find the z-score for a population value of 8. c. What number has a z-score of 1.5?
Can a binomial distribution with parameters n = 10 and p = .1 be well approximated by a normal distribution?
Tristan Walker of Walker & Company says, "We are only going to design, develop, and test products and services uniquely tailored to our community's needs. I get it. I'm a part of the community we are...
Ace Cosmetics Corporation purchased land adjacent to its plant to improve access for trucks making deliveries. Expenditures incurred in purchasing the land were as follows: purchase price, $55,000;...
7. At this point you now know information about both the horizontal and the vertical components of the projectile's velocity. In the space below, draw a diagram of the vector components of Vx and...
Complete autonomy in how you demonstrate the following criteria. In this module, we talked more about leadership. We discussed the differences between leadership theory which is a well-substantiated...
Accustart Ltd. acquired 38% of the common shares of Lecce Ltd. on January 1, 2024, by paying $5.76 million for 144,000 shares. Lecce declared a cash dividend of $0.60 per share in each quarter that...
1. y + 2se (y) 2. se (p) 3. 2se (X-bar) 4. N (, 2 / n) 5. s / n 6. / n 7. 1 / (0.05) 2 8. [0,1] 9. p (1 p) / n 10. t 0.025 n1 (a) Sampling distribution of Xbar (b) Margin of error (c) 100%...
Refrigerant-134a enters an adiabatic compressor as saturated vapor at 120 kPa at a rate of 0.3 m3/min and exits at 1-MPa pressure. If the isentropic efficiency of the compressor is 80 percent,...
assume that we have only two following risk assets (stock 1&2) in the market. stock 1 - E(r) = 20%, std 20% stock 2- E(r) = 10%, std 20% the correlation coefficient between stock 1 and 2 is 0. and...
Flexible manufacturing places new demands on the management accounting information system and how performance is evaluated. In response, a company should a. institute practices that reduce switching...
Revenue and expense items and components of other comprehensive income can be reported in the statement of shareholders' equity using: U.S. GAAP. IFRS. Both U.S. GAAP and IFRS. Neither U.S. GAAP nor...

A population has mean = 30 and standard deviation = 6. a. Find the z-score

Question:

Step by Step Answer:

a Zscore for a value of 21 We can calculate the zscore using the formula z x where ...View the full answer

Elementary Statistics

Students also viewed these Business questions