A population has mean = 10 and standard deviation = 4. a. Find the z-score

Question:

A population has mean μ = 10 and standard deviation σ = 4.

a. Find the z-score for a population value of 14.

b. Find the z-score for a population value of 8.

c. What number has a z-score of 1.5?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Elementary Statistics

ISBN: 9781259969454

3rd Edition

Authors: William Navidi, Barry Monk

See More Books

Question Posted: May 03, 2024 04:02 AM

See More Questions

Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...
28. The best explanation for the titration results represented by the following graph is Hd 14 13 12 10 9 8 7 6 5 4 3 2 1 0 0 Titration Curve for Titration of 37 mL of 0.10 mol/L H3PO4(aq) with...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
choess answaer that How many bits are required to store one BCD digit?" 2 8 1 Kilo bits are equal to 1000 bits 1024 bits 1012 bits 1008 bits The function of the encoder is to convert coded...
Kent Market (KM) is a major food cooperative. Suppose KM begins 2017 with cash of $5 million. KM estimates cash receipts during 2017 will total $103 million. Planned payments will total $93 million....
Prepare consolidated workpapers for firms with upstream and downstream sales using the cost, partial equity, and complete equity methods. LO5
Why might calculating working capital as a fixed percentage of sales be a reasonable simplifying assumption?
An office employs several clerks who create documents and one operator who enters the document information in a computer system. The group creates documents at a rate of 25 per hour. The operator can...
QUESTION ONE-(30 MARKS) On a Saturday morning in late September 2015, Desiree Mofakye sat over her breakfast, which was rapidly turning cold, and reflected on the performance of her personal...
A population has mean = 30 and standard deviation = 6. a. Find the z-score for a population value of 21. b. Find the z-score for a population value of 42. c. What number has a z-score of 0.5?
Four employees in an office have annual salaries of $$30,000$, $$35,000$, $$45,000$, and $70,000. a. Compute the sample standard deviation of the salaries. b. Each employee gets a $$1000$...
2. For each of the following, evaluate I Is curl F . nda. (a) 8 is the "bottomless" surface in the upper half space z 2 bounded by y = x2, Z = 1 - y, n is the outward-pointing normal, and F(x,y,z) =...
A carload of Hg-ore containing grains of cinnabar (86%Hg by mass; density = 8.19 g/cm3) and grains of basalt (containing no Hg; density=2.84 g/cm3) is to be sampled and analyzed for mercury. The...
CMS reviews acute IPPS and long-term care hospital (LTCH) records for payment purposes. Documentation and coding assignment must be accurate and specific. CMS contracts with Medicare Administrative...
Problem 2. x3+2x+1 f(x) = = 5-x 8H xx (4 points) Without graphing the function, find the limits lim f(x) and lim f(x) analyt- ically and show your work. Specify if the limits are - or +. (1 point)...
For change management, answer the following questions in detail, citing some industry examples: 1. What would you do if your manager requested you change your way of working on a project? 2. What do...
1.Sony has just released a new CD recording (okay, not new because we don't buy CDS) but anyway.Here is some cost and price information: CD Disc and Packaging (material and labor) $1.75/CD...
1. A sampling distribution describes the variability among average weights from day to day. 2. Before using a normal model for the sampling distribution of the average package weights, the manager...
What is the back work ratio? What are typical back work ratio values for gas-turbine engines?
please help Problem 13-7 (Algo) Prepare a Statement of Cash Flows [LO13-1, LO13-2] [The following information applies to the questions displayed below.] Comparative financial statements for Weaver...
A firm has 1000 shareholders, each of whom own $59 in shares. The firm uses $28000 to repurchase shares. What percentage of the firm did each of the remaining shareholders own before the repurchase,...
Vancouver Bank agrees to lend $ 180,000 to Surrey Corp. on November 1, 2020 and the company signs a six-month, 6% note maturing on May 1, 2021. Surrey Corp. follows IFRS and has a December 31 fiscal...

A population has mean = 10 and standard deviation = 4. a. Find the z-score

Question:

Step by Step Answer:

a To find the zscore we use the formula z X where X is the population value is the mean an...View the full answer

Elementary Statistics

Students also viewed these Business questions