Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to

Question:

Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to produce gelatin.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Fundamentals Of Biochemistry Life At The Molecular Level

ISBN: 9781118918401

5th Edition

Authors: Donald Voet, Judith G Voet, Charlotte W Pratt

See More Books

Question Posted: Oct 04, 2023 06:56 AM

See More Questions

A common and important process is the manufacture of gelatin for food, pharmaceuticals, photographic film, and various technical applications. The chemistry is the simple hydration of collagen from...
PART A) Gelatin is processed collagen that comes from the bone and joints of animals. Collagen is a structural protein consisting of a triple helix three polypeptide chains wound around each other....
(a) Which is generally stronger, intermolecular interactions or intramolecular interactions? (b) Which of these kinds of interactions are broken when a liquid is converted to a gas?
Determine A in the indicated figures. Fig. 2.40 (a) A 84 (a) 40 B
What are the three main tasks the operating system performs?
Q2 How does business process management vary in scope?
True or False. Regression models fit to time-series data typically result in uncorrelated errors.
Gonzalez Company acquired $200,000 of Walker Co., 6% bonds on May 1 at their face amount. Interest is paid semiannually on May 1 and November 1. On November 1, Gonzalez Company sold $70,000 of the...
20- QuickBooks maintenance activities can be performed on which of the following? Select one: a.Maintenance can be performed on all of these items b.General ledger accounts c.Vendors d.Employees...
The coat protein of tomato bushy stunt virus consists of 180 chemically identical subunits, each of which is composed of 386 amino acid residues. The probability that a wrong amino acid residue will...
The GroEL/ES cycle diagrammed in Fig. 6-45 circulates only in the clockwise direction. Explain the basis for this irreversibility in terms of the sequence of structural and binding changes in the...
A submerged spherical steel buoy that is 1.2 m in diameter and weighs 1800 N is to be anchored in salt water 50 m below the surface. Find the weight of scrap iron that should be sealed inside the...
A retail product has the following standard costs established: Direct Material per unit - 2 pounds at $5 a pound Direct Labor per unit - 3 hours at $12 an hour Manufacturing Overhead - $5 per labor...
In a recent year, the Better Business Bureau settled 75% of complaints they received. (Source: USA Today, March 2, 2009) You have been hired by the Bureau to investigate complaints this year...
A 1200-ft equal tangent crest vertical curve is currently designed for 50 mph. A civil engineering student contends that 60 mph is safe in a van because of the higher driver's eye height. If all...
Required information [The following information applies to the questions displayed below.] Victory Company uses weighted-average process costing to account for its production costs. Conversion cost...
Finer, % 100 90 80 70 60 50 40 30 20 10 0 0.01 0.1 1 Size, mm L 10 100 Figure shows a grain size distribution curve of soil. Estimate the coefficient of curvature (Cc) of this soil.
A citizen group raised funds to establish an endowment for the Eastville City Library. Under the terms of the trust agreement, the principal must be maintained, but the earnings of the fund are to be...
What kind of financial pressures can an LBO cause?
Predict the effect on protein structure and function of an AT to GC transition in the first codon position for lysine?
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Describe how nucleotide substitutions at different positions in codons affect the characteristics of the encoded amino acids?
Discuss American History
Your firm has developed a new lithium ion battery polymer that could enhance the performance of lithion ion batteries. These batteries have applications in many markets including cellphones, laptops,...
Need help analyzing statistical data 1. ANOVA) True or false: If we assume a 95% confidence level, there is a significant difference in performance generally across all groups. 2. (t-test) True or...

Describe the intra-and intermolecular bonds or interactions that are broken or retained when collagen is heated to

Question:

Step by Step Answer:

When collagen is heated to produce gelatin several intra and intermolecular bonds or interactions are broken or retained in the process Collagen is a ...View the full answer

Fundamentals Of Biochemistry Life At The Molecular Level

Students also viewed these Sciences questions