Consider the problem of searching for genes in RNA sequences using the Boyer-Moore algorithm. An RNA sequence consists of a text on the alphabet {A, C, G, U} and the gene or gene segment is the pattern. Construct the bad symbol shift table for the pattern CCCAAA. Construct the good suffix shift table for the pattern CCCAAA. Apply Horspools algorithm to locate CCCAAA in the following RNA sequence: GUAGAAGGAAGCCAAACCCAAA Apply the Boyer-Moore algorithm to locate CCCAAA in the following RNA sequence: GUAGAAGGAAGCCAAACCCAAA