DNA sequences can be viewed as strings of A, C, G, and T characters, which represent nucleotides. Finding the similarities between two DNA sequences is an important computation performed in bioinformatics. Given two DNA X and Y. Write a program to find the best alignment in terms of longest subsequence. X: ACCGGTCGAGTGCGCGGAAGCCGGCCGAA Y: GTCGTTCGGAATGCCGTTGCTCTGTAA DNA sequences can be viewed as strings of A, C, G, and T characters, which represent nucleotides. Finding the similarities between two DNA sequences is an important computation performed in bioinformatics. Given two DNA X and Y. Write a program to find the best alignment in terms of longest subsequence. X: ACCGGTCGAGTGCGCGGAAGCCGGCCGAA Y: GTCGTTCGGAATGCCGTTGCTCTGTAA