Question
From a txt file named BAK1_gene_seq containing just a string of DNA sequence, write a Python program that calculates the AT content and GC content
From a txt file named "BAK1_gene_seq" containing just a string of DNA sequence, write a Python program that calculates the AT content and GC content of the whole gene.
Sample output: BAK1's AT content is 30%
The file is a plain text file that contains the gene's sequence:
GCCGGGTGCCGCTGGCACCTCTATGATCACTGGAGTCTCGCGGGTCCCTC GGGCTGCACAGGGACAAGTAAAGGCTACATCCAGATGCCGGGAATGCACT GACGCCCATTCCTGGAAACTGGGCTCCCACTCAGCCCCTGGGAGCAGCAG CCGCCAGCCCCTCGGGACCTCCATCTCCACCCTGCTGAGCCACCCGGGTT GGGCCAGGATCCCGGCAG....
Python program should be able to open the file, read it, and calculate the percent of A's and T's within the sequence, as well as G's and C's.
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started