please answer all for thumps up:)

The PAM substitution matrix was an important development in bioinformatics. Please select all of the choices below that are features of PAM. A large number in PAM (e.g., PAM250) is suitable for aligning sequences from distantly related species. PAM was developed by Dr. Margaret Dayhoff. PAM is flexible and useful for aligning amino acid (protein) and nucleic acid (DNA) sequences. PAM is based on global alignments of protein sequences. Which of these genome sequencing technologies can yield the longest reads? Illumina 454 Sanger Nanopore Choose the example sequence below that is a FASTA formatted sequence. > AG3_Helianthus_annuus ATTATGTTAGCCAGTACAATTCGTACCGTACCTTAAGCCGGTATCAGTTACGGTACGTACCAGT +AG3_Helianthus_annuus ATTATGTTAGCCAGTACAATTCGTACCGTACCTTAAGCCGGTATCAGTTACGGTACGTACCAGT ATTATGTTAGCCAGTACAATTCGTACCGTACCTTAAGCCGGTATCAGTTACGGTACGTACCAGT. >AG3_Helianthus_annuus_ATTATGTTAGCCAGTACAATTCGTACCGTACCTTAAGCCGGTATCA Which of these sequencing technologies does NOT use light to detect base pair incorporation? 454 Ion Torrent Sanger Nanopore Illumina PacBio One approach to find approximate matches is to use a strategy known as filtration. What is the basic logic of filtration? Filtration refers to the practice of drinking a cup of filtered coffee before trying to find approximate matches. The caffeine from the filtered coffee helps us remember the correct answer. Filtration removes all of the areas of the sequences that do not overlap to reduce computational time. Any pair of sequences with k mismatches will also have multiple exact matches that can be found with existing exact matching approaches (e.g., suffix trees). If you keep k small, this can generally be an efficient way to find approximate matches. A pair of sequences will share multiple k-mers that can be used to seed the alignment. What biological process(es) creates "gaps" in pairwise nucleotide sequence alignments? Insertion or deletion of a nucleotide in one sequence but not the other Rearrangement of a string of nucleotides Substituting one nucleotide for another Nothing; gaps are always artifacts of the alignment algorithm A two-dimensional dynamic programming table (check all that are correct) can be constructed in running time that is proportional to nm, the dimensions of the table can be extended to many dimensions for multiple sequence alignment problems, but this is not very practical is used to solve the pairwise global alignment problem leads to efficient exact solutions of the pairwise local alignment