The Bacterium should be Bacillus Cereus

DNA Sequence: gtggtttaattcgaagcaacgcgaagaaccttaccaggtcttgacatcctctgaaaaccc

Bacterium: Bacillus Subtllls DNA sequence: Morphological Characteristics Gram reaction: positive Cell shape: rod Cell size: 1.0 x 3-4.0 um Acid-fast: negative Arrangement: singly, chains Endospores present: positive Capsule present: negative Motility: positive Cultural Characteristics Optimum temperature: 30' C (grows at 20-45' C) Oxygen requirement: facultative anaerobe Colony morphology on TSA plate: entire, irregular, flat, rough, swarming, opaque, gray or dull white Pattern of growth on TSA slant: effuse, spreading Pattern of growth in TSB: pellicle Type of hemolysis on BAP: Beta (can vary) Physiological Characteristics Oxidation/Fermentation tests Glucose (dextrose) fermentation: Acid Lactose fermentation: negative Mannitol fermentation: negative Sucrose fermentation: Acic Oxidation/Fermentation of glucose: O+/F+ Methyl Red (fermentation via mixed acid pathway): Voges-Proskauer (fermentation via butanediol pathway: positive Citrate utilization: positive Nitrate reduction: positive Oxidase test: varies Hydrolytic and Degradative tests: Catalase (breakdown of hydrogen peroxide): positive Gelatin (gelatin hydrolysis): positive Starch (amylase hydrolysis): positive Skim milk (casein hydrolysis): positive Urea (urea hydrolysis): varies Indole (tryptophan hydrolysis): negative Phenylalanine (phenylalanine deamination): negative Other tests: Hydrogen sulfide production: negative DNase (DNA depolymerization): Arginine (arginine decarboxylation): negative Lysine (lysine decarboxylation): negative Ornithine (ornithine decarboxylation): negative Notes: Lipase: PositiveHere are ideas for your one required Table in your report: Your table must include Essential and Non essential tests, but it's up to you exactly how you design your table... Table 1: Tests used in the identification of Tests or feature Gram reaction and shape Yes Arrangement No Acid fast No Endospores _ Capsules Motility Yes Oxygen requirement Yes Optimum temp Pigment (from growth on TSA Yes plate or slant] Fermentation of glucose Yes Fermentation of lactose Or Table 1.1 Tests used in the identification of Tests or feature m Non-essential X Gram reaction and shape Arrangement Acid fast Endospores Capsules Motility Oxygen requirement Optimum temp Pigment (from growth on TSA X plate or slant] Fermentation of glucose X >