The information listed below summanizes the current state of our knowledge concerning Syndrome X. All of the data presented are real. The actual name of the syndrome has been fabricated so as not to deprive our students of the intellctual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. a) Syndrome X is a human genetic disorder that results from a defeet at one genetic locus and patients with the disorder manifest pleiotropic effects that occur during embryonic development. These effects include malformation of the anterior of the eye (which causes the eye discase known as glaucoma in 50% of Syndrome X patients), mikd head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Familics displaying the discase were examined for linkage of the discase locus to a polymorphic site unique to cach family. From such studics scientists were able to report linkage of the gene that is defective in the disorder to chromosome 4. (From this point on we will use the term "gene s" to designare the normal form of the gene that is defective in Syndrome X.) c) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a cDNA library, and ultimately isolated a full length cDNA clone coding for the normal gene x. Subscquently, they isolated a human genomic clonc coding for gene x. d) The cDNA clone as well as parts of the genomic clone were sequenced. The results are shown in Fig. 1. e) since nothing was known about the structure or function of the protein encoded by gene x, scientists deduced its amino acid sequence from the cDNA nucleotide sequence of gene x and used it for further studies. The deduced amino acid sequence was analyzed via software capable of predicting with some degree of accuracy, the secondary structure of a protein ( but not the complete tertiary structure) and the presence of a helix-turn-helix was revealed. ) Mutant gene x isolated from members of 10 different families diagnosed with Syndrome X were analyzed to identify the mutations therein. One family showed the following mutation. Nuckotide number 981 was changed from a G to an A as shown in Fig.i. The other nine families showed other distinet mutations. 8) It is often helpful when studying human genetic disorders to have a mouse model of the discase as well as a mouse eDNA clone for the gene under study. F'or this reason, scientists isolated a mouse el)NA clone whose deduced amino acid sequence showed a 91% similarity to the deduced amino acid sequence for human gene Uslizing all of the data presented, in conjunction with the many concepts that you have learned this semester, answer the questions that follow. 3. (15 pts) How large is the cDNA? How many amino acids make up protein x? Predict an approximate molecular weight of protein X in Daltons (use 100 as average molecular weight of an amino acid). 4. (10 prs) How did the mutation at nucleotide 981 change the secquence of protein x? This mutation obviously had a detrimental effect on the function of the protein x. Provide an explanation for this dekterious effecet. 5. (25) You have been tokd that scientists isolated a mouse eDNA that encoded a protcin similar to that encoded by the human gene x. Assume it is your task to isolate the normal mouse eDNA for gene x. Design an experiment to do this. If you choose to screen a library, make sure to indicate 1) from what mouse tissue you would isolate the mRNA for your cDNA ibrary construction 2) what probe you would use to screen the library. Be brief and to the point. 6. (25) Assume you are a genetic counselor and the family with the G to A base change (already has one child effected with Syndrome X) is expecting a child and inquires if a prenatal diagnosis could be done to determine if this chikl were affected. The clones, general knowkdge concerning the mutation in this family and current state of the art of biotechnology, design a prenatal test for this family. Be brief and to the point. Pedigree of A Syndrome X Famly 1004 GOCTcceTATCCACCARSAGCTreecerTCTTCAASTCTATGAAC Alaserleuser ThelyaderPhePeePhePheAanserNetAee 155 101 151 201 251 201 351 1049 GTCAACCccerorCATCACAGAGCATGTTTICcCCMcCCAACICT ValkantroleuserserGinsacMetPhesertrotrokanser 170 CAGC GAS 1094 ATCtcorcCAZGAGCATGrCorocAGCATGGrGcccrCAGCAGTG ieserserMetserMetsersersetMetvaltrederalaval 185 451 501 GAGO AGO 1139 ACAGOCrcecocccreCACTCTCAACAGCCIGAATAACTIGAAC Met GiuThrAsscya cCCAAACTOGTGTccacerarerSCAATTAGgtaagaaccecet AretyalevalderAlacyavaiGinies 15 114 AACCrGAGTAGCceGreae TGAATTCescsorscCGAcaccrsce Aanieuserder7roferteukanserAlavaltrothrtrokle 235 teteetg tgtgtttcegtttcagAGAARGATAAAAGE ClulysAsplysser 20 1229 TGTCCTTACGEGccsccGACTCCrecOTATOTATAGGGACACG CyatretyralaProProthedretrotyrvaityrargaspThr 230 CAGCAGGGGAAGRATGAGGACGTOsacGcCGAGGACCCorCTAAG CiEcinciyiyaksnGiukapvaliyAaGluaapproserLys 44 1274 TOEAACTCGAGCCroscCAGcTGAGACTGAAAGCAAAGCAGCAC CysAserserteAiaserleuaretealyaAleiysolatis 245 35 AAGAAGCOOCAAAG CACTETACSARCCAOCAG 50 1319 TCCAGCTIcoactAcocCAocoICCAGAAALCOGCCrCCAACCIG Serser PheblytyrAlafervalGIalyatroAlaserEAleu 260 734 SICCACCARCTOCAPGCCACECCAGAGGAACCOCTAcccOGAC 65 1364 AGTGCIoCCAGIATOCACIcACCGacccaTeTA, GCCOCACCCAC SecAlacysGintyEAiavalAspargrovaistop 271 TGAAA 1411 AGCGCCGGGAT 1461 GACTGGGAATTATO 1511 1561 1611 ATGTCCACACGCGAAGAAATCGCTOTG GACCAACCTTACOGAA AGAGAAA AGCTOCT 79 ACTGAATC GAGAAGCTATATA TGATTCA CACATT AACAT TATA 1711 1761 1011 1861 1911 1961 GT 2011 ATAACA 2041 AATGTG 2111 AAAAM SESSGAGTECStgapccagescggagtet cecttgecce AlaargvalArg 24 GAGCAA aacegeccocagEGGTICAAGAATCSICGGGECAAATGSAGA MAAAAAA AAGAGGGASCGCAACCAGCAGSCCGAGCTATGCAAGAATGGCTTC 110 Fig I Nucleotide and deduced amino acid sequence of the human gene x. In sequence (shown in lower case) was determined only at intron-exon junctio 125 The start (ATG) and stop (TGA) codons are in boldface, as are the conser gt and ag sequences flanking each intron and the polyadenylation signals in 140 untranslated region Multiple stop codons S from the initiation methionine a underlined GGGCcGCASITCAATGoacICATGCAGCeCTACGACGACATOTAC GlyPreGiaPheasnciyleuhetGlaProtyrAspaspnetTyr 914 CCAGGCTATICCTACAACAACtcoceoCCAAGGGCCTTACATCe PreGlytyrsertyrAnnAantepaianlalysGlyleutarSer 159 Question 1 The information listed below summarizes the current state of our knowledge concerning Syndrome X All of the data presented are real. The actual name of the syndrome has been fbricated so as not to deprive our students of the intellectual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. D Syndrome X is a human genetic disorder that results from a defect at one genetic locus and parients with the disorder manifest pleiotropic effects that occur during embryonie development. These effects include malformation of the anterior of the cye (which causes the eye disease known as glaucoma in 50%% of Syndrome X patients), mild head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Families displaying the disease were examined for linkage of the disease locus to a polymorphic site unique to each family. From such studies scientists were able to report linkage of the gene that is defecuve in the disorder to chromosome 4. (From this point on we will use the term "gene x" to designate the normal form of the gene that is defective in Syndrome X.) ) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a CDNA library, and ultimately isolated a full length CDNA clone coding for the nomal gene x. Subsequently, they isolated a human genomic clone coding for gene x. Pedigree of A Syndrome X Fa mily 28