Use python to answer!

oneFrane Write a function oneframe (DNA) that starts at the 0 position of DNA and searches forward in units of three looking for start codons. When it finds a start codon, onefrane should take the slice of DNA beginning with that "ATG" and ask restoFOrF for the open reading frame that begins there. It should store that sequence in a list and then continue searching for the next "ATG start codon and repeat this process. Ultimately, this function returns the list ot all ORFs that it found. Here are some examples of oneFrane in action onefrane ( ccCTTTTTGAAAATOCCCGGGTAA-) >>> oneFrane("CCATGTAGAAATGCCC") [1 >oneFrane("ATGCCCATGGGGAAATTTTGACCC") 'ATOCCCATOGGGAAATTTATG0GGAAATTT