We are given a short DNA sequence: ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCG A) It comprises two exons and an intron. The first exon runs from the 1 st character of the sequence to the 24 th character, and the second exon runs from the 44th character to the end of the sequence. Write a program, named introns1.py, that will print just the coding regions of the DNA sequence. B) Using the data from part A, write a program, named introns2.py, that will calculate what percentage of the DNA sequence is coding. C) Using the data from part one, write a program, named introns3.py, that will print out the original genomic DNA sequence with coding bases in uppercase and non-coding bases in lowercase.