Write a Python function in a Google Colab $$ notebook that translates the given RNA sequence,

AUGGGCGGAUACCCCUUAUUG, to its corresponding amino acid sequence based on the codon chart

below. Describe what each line of your function does. You can submit either a link to the notebook, or

download and attach it to this assignment.

Second letter