Question
write two programs to implement the two formulations of the problem of motif finding. summarize your work with the source code and the testing results
write two programs to implement the two formulations of the problem of motif finding.
summarize your work with the source code and the testing results for comparing the two formulations.
Running Format: C> a.out sequence.fasta output.txt
The format of the input fasta files: The following is an example to demonstrate the input format. >SEQUENCE_1 atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagc agatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcgggatgagtatccctgggatgacttaaaataatggagt ggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga >SEQUENCE_2 gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaat gtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttataggtcaatcatgttcttgtgaatggatttaacaata agggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa >SEQUENCE_3 cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttaaaaaata gggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatgg aagatagaatccttgcatactaaaaaggagcggaccgaaagggaag
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started