Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

write two programs to implement the two formulations of the problem of motif finding. summarize your work with the source code and the testing results

write two programs to implement the two formulations of the problem of motif finding.

summarize your work with the source code and the testing results for comparing the two formulations.

Running Format: C> a.out sequence.fasta output.txt

The format of the input fasta files: The following is an example to demonstrate the input format. >SEQUENCE_1 atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagc agatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcgggatgagtatccctgggatgacttaaaataatggagt ggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga >SEQUENCE_2 gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaat gtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttataggtcaatcatgttcttgtgaatggatttaacaata agggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa >SEQUENCE_3 cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttaaaaaata gggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatgg aagatagaatccttgcatactaaaaaggagcggaccgaaagggaag

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image_2

Step: 3

blur-text-image_3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Upgrading Oracle Databases Oracle Database New Features

Authors: Charles Kim, Gary Gordhamer, Sean Scott

1st Edition

B0BL12WFP6, 979-8359657501

More Books

Students also viewed these Databases questions

Question

Explain the function and purpose of the Job Level Table.

Answered: 1 week ago