A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts

Question:

A hypothetical base sequence of an RNA molecule is 5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′ Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in this RNA.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Genetics Analysis And Principles

ISBN: 9781260473063

7th Edition

Authors: Robert Brooker

See More Books

Question Posted: Apr 05, 2024 05:00 AM

See More Questions

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
CANMNMM January of this year. (a) Each item will be held in a record. Describe all the data structures that must refer to these records to implement the required functionality. Describe all the...
The new line character is utilized solely as the last person in each message. On association with the server, a client can possibly (I) question the situation with a client by sending the client's...
In Exercises 6780, begin by graphing the square root function, f(x) = x. Then use transformations of this graph to graph the given function. h(x) = x + 1 1 Vx+1-1
Assume a company uses a plantwide predetermined manufacturing overhead rate, which is calculated using direct labour hours as the cost driver. The use of this plantwide predetermined MOH rate has...
To what extent, according to Plato, is it easy to change people? To what extent does he believe it is easier to change ideas? Why does Plato consider it easier to maintain the status rather than to...
What might it mean if a forecasting method has no bias yet has a large MAD? LO.1
Alley Corporation recently organized. The company issued common stock to an inventor in exchange for a patent with a market value of $56,000. In addition, Alley received cash both for 2,000 shares of...
QUESTION 34 Name and breifly describe 3 of the budgets prepared as part of the Master budget
Within living cells, many different proteins play important functional roles by binding to DNA. Some proteins bind to DNA but not in a sequence-specific manner. For example, histones are proteins...
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
Segment margin . represents the excess of revenues over direct vari- able expenses and avoidable fixed expenses of a specific product/service line. measures the segment's contribution to the cov-...
Convert the following information into: a) a semantic net b) a frame-based representation A Ford is a type of car. Bob owns two cars. Bob parks his car at home.His house is in California, which is a...
Visit www.pearsonglobaleditions.com/malhotra to read the video case and view the accompanying video. Marriott: Marketing Research Leads to Expanded Offerings highlights Marriotts success in using...
The water level in a tank is $20 \mathrm{~m}$ above the ground. A hose is connected to the bottom of the tank, and the nozzle at the end of the hose is pointed straight up. The tank cover is...
A simple experiment has long been used to demonstrate how negative pressure prevents water from being spilled out of an inverted glass. A glass that is fully filled by water and covered with a thin...
A golf ball is hit on a level fairway. When it lands, its velocity vector has rotated through an angle of 90. What was the launch angle of the golf ball? Pyo By Dyz =0 Uso Range R x max dya
Johnson correctly values its 2017 ending inventory '. What is the effect of this error on Boryss 2016 and 2017 financial statements?
Explain why it is not wise to accept a null hypothesis.
Chapter o Homew ebook 50,000-unit production quantity: $ 227,049 7 70,000-unit production quantity: $ 66,751 d. In addition to mean profit, what other factors should FTC consider in determining a...
Diamond makes downhill ski equipment. Assume that comic has offered to produce ski poles for Diamond for $20 per pair Diamond needs 200,000 pairs of poles per period Diamond can only avoid 5150,000...
17? Which of the following statement is true Select one: a. All evidence must have the same level of reliability b. All evidence must have the same level of persuasiveness C. All are false d....

A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts

Question:

Step by Step Answer:

Here are two possible stemloop structures that cou...View the full answer

Genetics Analysis And Principles

Students also viewed these Sciences questions