Questions and Answers of Structural Analysis

Resistance to the poison warfarin is a genetically determined trait in rats. Homozygotes carrying the resistance allele (WRWR) have a lower fitness because they suffer from vitamin K deficiency, but
Describe, in as much experimental detail as possible, how you would test the hypothesis that the distribution of shell color among land snails is due to predation.
Which of the following is an example of a quantitative trait?a. Heightb. Rate of glucose metabolismc. Ability to learn a mazed. All of the above are quantitative traits.
Saying that a quantitative trait exhibits a continuum means thata. the numerical value for the trait increases with the age of the individual.b. environmental effects are additive.c. the phenotypes
The variance isa. a measure of the variation around the mean.b. computed as a squared deviation.c. higher when there is less phenotypic variation.d. Both a and b are correct.
Which of the following statistics is used to compare two variables?a. Meanb. Correlation coefficientc. Varianced. Standard deviation
1. For many quantitative traits, phenotypes due to different genotypes tend to overlap becausea. the trait changes over time.b. the trait is polygenic.c. environmental variation affects the trait.d.
A QTL is a __________ where one or more genes affecting a quantitative trait are ________ .a. site in a cell, locatedb. site on a chromosome, locatedc. site in a cell, expressedd. site on a
To map QTLs, researchers cross strains that differ with regard toa. a quantitative trait.b. molecular markers.c. a quantitative trait and molecular markers.d. a quantitative trait and a discontinuous
In a population of squirrels in North Carolina, the heritability for body weight is high. This means thata. body weight is primarily controlled by genes.b. the environment has little influence on
If two or more different genotypes are not affected by environmental variation in the same way, this outcome is due toa. a genotype–environment association.b. a genotype–environment
One way to estimate narrow-sense heritability for a given trait is to compare __________ for _________.a. variances, related pairs of individualsb. correlation coefficients, related pairs of
For selective breeding to be successful, the starting population musta. have genetic variation that affects the trait of interest.b. be very large.c. have the potential for phenotypic variation
The mean weight of cows in a population is 520 kg. Animals with a mean weight of 540 kg are used as parents and produce offspring that have a mean weight of 535 kg. What is the narrowsense
The following data describe the 6-week weights (in grams) of mice and their offspring of the same sex:Calculate the correlation coefficient. Parent's weight (g) Offspring's weight (g) 24 26 21 24 24
A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this codon in the transcribed mRNA into GUA (valine), AUA (isoleucine), CUA (leucine), UGA (stop), UAA
Are the following statements regarding heritability true or false?A. Heritability applies to a specific population raised in a particular environment.B. Heritability in the narrow sense takes into
For each of the following relationships, correlation coefficients for height were determined for 15 pairs of individuals:Father-daughter: 0.41 Father-granddaughter: 0.18 Sister-sister: 0.40
Evolution that results because certain genotypes have a higher reproductive success is based ona. genetic variation.b. natural selection.c. genetic drift.d. both a and b.
Characteristics that are used to establish species includea. morphological traits.b. reproductive isolation.c. molecular features.d. ecological factors.e. evolutionary relationships.f. all of the
A pair of birds flies to a deserted island and establishes a colony.Over time, this population evolves into a new species. This is an example ofa. allopatric speciation.b. parapatric speciation.c.
The formation of polyploids is common in plants and can abruptly produce a new species. This is an example ofa. allopatric speciation.b. parapatric speciation.c. sympatric speciation.d. all of the
Phylogenetic trees are based ona. natural selection.b. genetic drift.c. homology.d. none of the above.
A shared derived character isa. derived from an ancestral character.b. more recently developed than an ancestral character.c. found in all or most of the members of an ingroup.d. all of the above.
An approach that is used to construct and/or choose the most likely phylogenetic tree isa. cladistics and the principle of parsimony.b. phenetics.c. maximum likelihood or Bayesian methods.d. all of
Horizontal gene transfer is a process in which genetic material from an organism isa. transferred from cell to cell.b. transferred to its offspring.c. transferred to another organism that is not the
Homologous genes found in different species are calleda. orthologs.b. paralogs.c. analogs.d. none of the above.
A molecular clock may not be linear becausea. mutation rates may differ among different species.b. differences in population sizes may affect the relative effects of natural selection and genetic
When the chromosomes of closely related species are compared,a. the banding patterns are often similar.b. a few structural alterations may be seen.c. a change in chromosome number may be seen.d. all
Explain why orthologs have sequences that are similar but not identical.
Evolution is associated with changes in chromosome structure and number. As described in Figure 29.16, chromosome 2 in humans is divided into two distinct chromosomes in chimpanzees, gorillas, and
Discuss the two factors on which adaptive evolution is based.
What is meant by the term reproductive isolation? Give several examples.
The pedigree presented here shows the incidence of a human disease known as familial hypercholesterolemia in a certain family.This disorder is characterized by an elevated level of serum cholesterol
Some prion-related diseases, such as familial fatal insomnia, are inherited. How would you expect the mutation has altered the PrP gene in this case? Would it have affected the promoter, the
In lung tumors in cigarette smokers, a mutation that is commonly found is a mutation in the ras gene that prevents the Ras protein from hydrolyzing GTP. Look back at the intracellular signaling
Oncogenes sometimes result from genetic rearrangements (e.g., translocations) that produce gene fusions. An example occurs in a Philadelphia chromosome, in which a reciprocal translocation between
Explain the functional roles of maternal-effect genes, gap genes, pair-rule genes, and segmentpolarity genes in Drosophila development.
Mutations in genes that control the early stages of development are often lethal (e.g., see Figure 26.7b). To circumvent this problem in studies of early development, developmental geneticists may
An intriguing question in developmental genetics is, how can a particular gene, such as even-skipped, be expressed in the alternating banding pattern seen in step 3 in Figure 26.11? Another way of
To answer this question, you need to look back at the evolution of the globin gene family in humans, which is shown in Figure 8.7.Throughout the evolution of this gene family, mutations have occurred
An RFLP marker is located 1 million bp away from a gene of interest. Your goal is to start at this RFLP and walk to the gene. The average insert size in the cosmid library is 55,000 bp, and the
Does a molecular marker have to be polymorphic to be useful in physical mapping studies? Does a molecular marker have to be polymorphic to be useful in linkage mapping (i.e., involving family
The distance between two molecular markers that are linked along the same chromosome can be determined by analyzing the outcomes of crosses. This can be done in humans by analyzing a family’s
Which of the following can appropriately be described as a transgenic organism?
What strategy would you follow to produce a human hormone in the milk of livestock?
Is each of the following events best explained by mutation or epimutation?A. Imprinting of the Igf2 gene B. V ariation in coat color in mice carrying the Avy alleleC. Formation of cancer cells D. V
Explain how a non-coding RNA could play a role in establishing an epigenetic modification at a specific site in a chromosome.
During embryonic development, what event causes one of the two X chromosomes to be remain active, whereas the other one becomes an inactive X chromosome?
Look back at Figure 16.12. If you crossed an F2 offspring to a homozygous B-I B-I plant, what phenotypic results would you expect for the F3 offspring?Figure 16.12: Cross strain A to strain B B' B' x
An ncRNA may have the following functions: scaffold, guide, alterer of protein function or stability, ribozyme, blocker, and/or decoy. Which of these functions are carried out by each type of ncRNA
An rRNA binds to a snoRNP that contains a C/D box snoRNA.What type of covalent modification would you expect this rRNA to undergo? Would it be methylated or pseudouridylated, or both?
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a
Discuss how the components of viruses assemble to make new virus particles. What is the difference between a virus that can self-assemble and one that cannot? Give examples.
Viruses may be latent for a long period of time. For example, HIV may be latent for many years, during which new viruses are not made.What are three different mechanisms of viral latency?
What is an emerging virus? Give two examples. Propose an experiment to explain how an emerging virus could arise.
If the mutation rate is 10–5 per gene per cell generation, how many new mutations per gene would you expect in a population of 1 million bacteria?
A reversion is a mutation that restores a mutant codon back to a codon that gives a wild-type phenotype. At the DNA level, this type of mutation can be an exact reversion or an equivalent
In the following schematic drawing of a Holliday junction, one chromatid is shown in red, and the homologous chromatid is shown in blue. The red chromatid carries a dominant allele labeled A and a
RNA was isolated from four different cell types and probed with labeled DNA strands from a cloned gene that is called gene X. The results are shown hereExplain the results of this experiment. Lane 1:
The sequence of a region of interest in a DNA template strand is 3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxy sequencing experiment anneals just to the left of this sequence,
The glucorticoid response element (GRE) has two copies of the sequence 5′-AGRACA-3′, where R is a purine. Given that the size of the human genome is about 3 billion bp, how many times would you
A drug called garcinol, isolated from Garcinia indica (a fruitbearing tree commonly known as kokum), is a potent inhibitor of histone acetyltransferase. Would you expect this drug to enhance or
Researchers have identified mutations in the promoter region of the lacI gene that make it more difficult for the lac operon to be induced. These are called lacIQ mutants, because their effect is
Explain how the pausing of the ribosome in the presence or absence of tryptophan affects the formation of a terminator (3–4) stem-loop,and describe how this affects transcription.
The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. However, the riboswitch in B. subtilis regulates transcription, whereas the one in E.coli
Describe the important events that occur during gene transcription in bacteria. What proteins play critical roles in the three stages?
The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′–TTAACA–3′. A mutation changes the fifth
When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template. Referring to Figure 12.4, explain how RNA polymerase determines which DNA strand is the template
As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at
An electrophoretic mobility shift assay (EMSA) can be used to study the binding of proteins to a segment of DNA. When a protein binds to a segment of DNA, it slows the movement of the DNA through a
In experimental question E3, an electrophoretic mobility shift assay can be used to determine if a protein binds to DNA. This method can also determine whether a protein binds to RNA. For each of the
The first amino acid in a purified bacterial polypeptide is methionine. The start codon in the mRNA is GUG, which codes for valine. Why isn’t the first amino acid N-formylmethionine or valine?
A tRNA has the anticodon sequence 3′–CAG–5′. What amino acid does it carry?
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by
A hypothetical base sequence of an RNA molecule is 5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′ Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might
Within living cells, many different proteins play important functional roles by binding to DNA. Some proteins bind to DNA but not in a sequence-specific manner. For example, histones are proteins
As described in Experiment 9A (see Figure 9.10), Chargaff determined the base composition of DNA from a variety of different sources. Explain how his data are consistent with the AT/GC rule.Figure
Suppose that a bacterial DNA molecule is given a left-handed twist. How does this affect the structure and function of the DNA?
Describe the differences between unique and highly repetitive sequences in DNA.
To hold bacterial DNA in a more compact configuration, specific proteins must bind to the DNA and stabilize its conformation. Several different proteins are involved in this process. Some of these
Describe three factors that account for the high fidelity of DNA replication. Discuss the quantitative contributions of each of the three.
Summarize the process of chromosomal DNA replication in E. coli.
As shown in Figure 11.24, telomerase adds additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes.However, it makes only one DNA strand. Describe how the opposite strand is
In the garden pea, orange pods (orp) are recessive to green pods (Orp), and sensitivity to pea mosaic virus (mo) is recessive to resistance to the virus (Mo). A plant with orange pods and sensitivity
Two recessive traits in mice—droopy ears and flaky tail—are caused by genes that are located 6 mu apart on the same chromosome.A true-breeding mouse with normal ears (De) and a flaky tail (ft)
The following X-linked recessive traits are found in fruit flies:vermilion eyes are recessive to red eyes, miniature wings are recessive to long wings, and sable body is recessive to gray body. A
As illustrated in Figure 6.9, a limit exists for the relationship between map distance and the percentage of recombinant offspring.Even though two genes on the same chromosome may be much more than
Describe how a gene family is produced. Discuss the common and unique features of the members of the globin gene family.
An inversion heterozygote has the following inverted chromosome:What is the result if crossing over occurs between genes F and G on an inverted and a normal chromosome in this individual? Centromere
In humans, the number of chromosomes per set equals 23. Even though the following conditions are lethal, what would be the total number of chromosomes for an individual with each condition?A. Trisomy
A diploid species with 44 chromosomes (i.e., 22 per set) is crossed to another diploid species with 38 chromosomes (i.e., 19 per set). How many chromosomes are found in an allodiploid or
Following a gene duplication, the two genes will accumulate different mutations, causing them to have slightly different sequences. In Figure 8.7, which pair of genes would you expect to have more
A diploid cell begins with eight chromosomes, four per set, and then proceeds through cell division. In the following diagram, in what phase of mitosis, meiosis I, or meiosis II is the cell?
What are the key differences in anaphase when comparing mitosis, meiosis I, and meiosis II?
Duchenne muscular dystrophy is a recessive disorder caused by a rare, loss-of-function allele that is located on the X chromosome in humans. An unaffected woman (i.e., without disease symptoms) who
Calvin Bridges, who worked in the lab of Morgan, made crosses to study the inheritance of X-linked traits in fruit flies. One of his experiments concerned two different X-linked genes affecting eye
In Ayrshire cattle, the coat can be either red and white or mahogany and white. The mahogany and white phenotype is caused by the allele SM. The red and white phenotype is controlled by the allele
The following pedigree represents a family in which a single gene causes an inherited disease. (Affected individuals are shown as filled symbols.) Assuming that incomplete penetrance is not
As shown in Figure 4.9, a gene in humans that occurs as the i, IA, and IB alleles encodes a glycosyl transferase that is involved in attaching galactose or N-acetylgalactosamine to an oligosaccharide

Showing 1 - 100 of 1426