New Semester
Started
Get
50% OFF
Study Help!
--h --m --s
Claim Now
Question Answers
Textbooks
Find textbooks, questions and answers
Oops, something went wrong!
Change your search query and then try again
S
Books
FREE
Study Help
Expert Questions
Accounting
General Management
Mathematics
Finance
Organizational Behaviour
Law
Physics
Operating System
Management Leadership
Sociology
Programming
Marketing
Database
Computer Network
Economics
Textbooks Solutions
Accounting
Managerial Accounting
Management Leadership
Cost Accounting
Statistics
Business Law
Corporate Finance
Finance
Economics
Auditing
Tutors
Online Tutors
Find a Tutor
Hire a Tutor
Become a Tutor
AI Tutor
AI Study Planner
NEW
Sell Books
Search
Search
Sign In
Register
study help
sciences
structural analysis
Genetics Analysis And Principles 7th Edition Robert Brooker - Solutions
As shown in Figure 4.18, coat color in rodents is governed by a gene interaction. An albino rat is crossed to a black rat. The ratio of their offspring is 1 agouti : 1 black : 2 albino. What are the genotypes of the parents?Figure 4.18: Egg AaCcx AaCc (Agouti) Sperm AC Ac AACC AACC AaCC AaCc AC
One strain of periwinkle plants has green leaves and another strain has white leaves. Both strains are true-breeding. You do not know if the phenotypic difference is due to alleles of a nuclear gene or an organellar gene.The two strains were analyzed using reciprocal crosses, and the following
A human male named Phillip has an X chromosome that is missing its Xic. Is this caused by a new mutation (one that occurred during gametogenesis), or could this mutation have occurred in an earlier generation and be found in the somatic cells of one of his parents? Explain your answer. How would
A maternal effect gene in Drosophila, called torso, is found as a functional allele (torso+) and a nonfunctional, recessive allele (torso−) that prevents the correct development of anterior- and posterior-most structures. A wild-type male (torso+ torso+) is crossed to a female of unknown
An individual named Pat with Prader-Willi syndrome produced an offspring named Lee with Angelman syndrome. The other parent does not have either syndrome. How might this occur? What are the sexes of Pat and Lee?
A human gene called the CFTR gene (for cystic fibrosis transmembrane regulator) encodes a protein that functions in the transport of chloride ions across the cell membrane. Most people have two copies of a functional CFTR gene and do not have cystic fibrosis. However, mutant version of the CFTR
Most genes encode proteins. Explain how proteins produce an organism’s traits. Provide examples.
As described in this chapter, a human disease known as cystic fibrosis is inherited as a recessive trait.Two unaffected individuals have a first child with the disease. What is the probability that their next two children will not have the disease?
In dogs, black fur color is dominant to white. Two heterozygous black dogs are mated. What is the probability of the following combinations of offspring?A. A litter of six pups, four with black fur and two with white fur B. A first litter of six pups, four with black fur and two with white fur,
A pea plant is heterozygous for three genes (Tt Rr Yy), where T = tall, t = dwarf, R = round seeds, r = wrinkled seeds, and Y = yellow seeds, y = green seeds. Tall, round, and yellow are the dominant traits. What is the probability that an offspring from self-fertilization of this plant will be
A pea plant that is (RrYy) is allowed to self-fertilize. Round seed (R) is dominant to wrinkled (r), and yellow seed (Y) is dominant to green (y). What is the probability of producing the following group of five seeds: two round, yellow; one round, green; one wrinkled, yellow; and one wrinkled,
A cross was made between a plant that has blue flowers and purple seeds and a plant with white flowers and green seeds. The F1 generation was then allowed to self-fertilize. The following data were obtained:F1 generation: All offspring have blue flowers with purple seeds.F2 generation: 208
The codon change (Gly-12 to Val-12) in human H-ras that converts it to oncogenic H-ras has been associated with many types of cancers. For this reason, researchers would like to develop drugs to inhibit oncogenic H-ras. Based on your understanding of the Ras protein, what types of drugs might you
Outline the general strategy used in metagenomics.
You need to understand the approach described in question 3 in More Genetic TIPS before answering this question. A muscle-specific gene was cloned and then subjected to promoter bashing. As shown here, six regions, labeled A–F, were deleted, and then the DNA was transformed into muscle cells.The
You need to understand the approach described in question 3 in More Genetic TIPS before answering this question. A gene that is normally expressed in pancreatic cells was cloned and then subjected to promoter bashing. As shown here, four regions, labeled A–D, were individually deleted, and then
Many researchers are interested in the transcription of protein-encoding genes in eukaryotes. Such researchers want to study mRNA. One method that is used to isolate mRNA is column chromatography.Researchers can covalently attach short pieces of DNA that contain stretches of thymines (i.e.,
The type of model building used by Pauling and by Watson and Crick involved the use of ball-and-stick units. Model building can now be done with computer software. Even though you may not be familiar with this approach, discuss potential advantages of using computers in molecular model building.
Based on the following pedigree for a trait determined by a single gene (affected individuals are shown as filled symbols), state whether it would be possible for the trait to be inherited in each of the following ways:A. Recessive B. X-linked recessive C. Dominant, complete penetrance D.
Personalized medicine may be useda. to characterize types of tumors.b. to predict the outcome of certain types of cancers.c. to determine the proper dosage of drugs.d. in all of the above.
Explain how DNA microarrays are used in molecular profiling of cancerous tumors.
A mutant gene that promotes cancer when it is overexpressed is calleda. a tumor-suppressor gene.b. an oncogene.c. both a and b.d. neither a nor b.
Which of the following is a type of genetic change that could produce an oncogene?a. Missense mutationb. Gene amplificationc. Chromosomal translocationd. All of the above can produce an oncogene.
Tumor-suppressor genes promote cancer whena. they are overexpressed.b. they are expressed in the wrong cell type.c. their function is inactivated.d. they are expressed at the wrong stage of development.
Normal (nonmutant) tumor-suppressor genes often functiona. as negative regulators of cell division.b. in the maintenance of genome integrity.c. in the stimulation of cell division.d. as both a and b.
Most forms of cancer involvea. the activation of a single oncogene.b. the inactivation of a single tumor-suppressor gene.c. the activation of multiple oncogenes.d. the activation of multiple oncogenes and the inactivation of multiple tumor-suppressor genes.
Which of the following types of epigenetic changes may promote cancer?a. DNA methylationb. Covalent modification of histonesc. Chromatin remodelingd. All of the above may promote cancer.
The underlying cause(s) of epigenetic changes associated with cancer may bea. mutations in genes that encode chromatin-modifying proteins.b. environmental agents that alter the function of chromatin-modifying proteins.c. mutations in genes that encode proteins that directly accelerate cell
Positional information may provide a cue for a cell toa. divide.b. migrate.c. differentiate.d. undergo apoptosis.e. do any of the above.
Molecules that convey positional information includea. diffusible morphogens.b. cell adhesion molecules.c. ATP.d. both a and b.
Which of the following is the correct order for the four developmental phases in animals?A. Segmentation of the body B. Determination C. Cell differentiation D. Formation of body axesa. A, B, C, Db. A, D, C, Bc. D, A, B, Cd. D, A, C, B
The expression of maternal-effect genes directly leads toa. the establishment of body axes.b. segmentation.c. determination.d. cell differentiation.
Which of the following are types of segmentation genes?a. Gap genesb. Pair-rule genesc. Segment-polarity genesd. All of the above are types of segmentation genes.
The expression of homeotic genes leads toa. the establishment of body axes.b. the formation of segments in the embryo.c. the determination of structures within segments.d. cell differentiation.
Homeotic genes encode proteins that function asa. cell-signaling proteins.b. transcription factors.c. hormones.d. all of the above.
Hox genes encode transcription factors thata. control segmentation.b. promote determination.c. cause cell differentiation.d. do all of the above.
A cell that is ___________ has a particular morphology and function.a. determinedb. differentiatedc. undergoing apoptosisd. dividing
Myogenic bHLH proteins are ___________ that promote ____________.a. cell-signaling proteins, muscle-cell differentiationb. cell-signaling proteins, muscle-cell determinationc. transcription factors, muscle-cell differentiationd. transcription factors, muscle-cell determination
The growth of plants is due to the division of __________, which are found in ___________.a. stem cells, the shootsb. stem cells, apical and basal meristemsc. somatic cells, the shootsd. somatic cells, apical and basal meristems
Flower development occurs in __________ according to _________.a. 3 whorls, maternal-effect genesb. 3 whorls, the ABC modelc. 4 whorls, maternal-effect genesd. 4 whorls, the ABC model
A key event that initially determines female or male development in Drosophila is thea. transcription of the Sxl gene.b. alternative splicing of the Sxl pre-mRNA.c. expression of the ix gene.d. expression of the her gene.
A mammalian embryo that is XY but is missing the SRY gene would be expected to develop intoa. a male.b. a female.c. a hermaphrodite.d. none of the above because sex differentiation would not occur.
In the procedure called RNA sequencing (RNA-Seq), what type of molecule is actually sequenced?
Describe the bioinformatics approaches that can be used to identify a protein-encoding gene.
Below is a short nucleotide sequence from a gene. Use a computer program from the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found.5′–GGGCGCAATTACTTAACGCCTCGATTATCTTC
Which of the following would not be consistent with the idea that a disorder has a genetic component?a. The disorder is more likely to occur among an affected person’s relatives than in the general population.b. The disorder can spread to individuals sharing similar environments.c. The disorder
Assuming complete penetrance, which type of inheritance pattern is consistent with the pedigree shown here?a. Autosomal recessiveb. Autosomal dominantc. X-linked recessived. X-linked dominant I-1 I-2 II-1 II-2 II-3 II-4 II-5 III-1 III-2 III-3 III-4 III-5 III-6
Which of the following is not a common explanation for a dominant disorder?a. Haploinsufficiencyb. A change in chromosome numberc. A gain-of-function mutationd. A dominant-negative mutation
Locus heterogeneity means that a genetic disordera. has a heterogeneous phenotype.b. is caused by mutations in two or more different genes.c. involves a structural change in multiple chromosomes.d. is inherited from both parents.
What is a haplotype?a. A species with one set of chromosomesb. A cell with one set of chromosomesc. The linkage of alleles or molecular markers on a chromosomed. All of the above describe a haplotype.
Haplotype association studies are aimed at the identification of a particular _________ based on _____________.a. chromosome, an abnormality in its structureb. chromosome, the arrangement of molecular markersc. gene, its linkage to other genes or molecular markersd. gene, chromosomal rearrangements
Which of the following is not a method used in genetic testing?a. Chromosome walkingb. DNA sequencingc. In situ hybridizationd. DNA microarrays
Which of the following prenatal genetic testing methods is done in conjunction with in vitro fertilization?a. Amniocentesisb. Chorionic villus samplingc. Preimplantation genetic diagnosisd. All of the above are usually performed in conjunction with in vitro fertilization.
A prion is a disease-causing agent composed ofa. cells.b. nucleic acid with a protein coat.c. protein alone.d. nucleic acid alone.
A means of introducing a cloned gene into cells for gene therapy is viaa. liposomes.b. retroviral vectors.c. T-DNA vectors.d. either a or b.
Which of the following best describes the approach that was used in the first gene therapy trial for treating SCID?a. The normal ADA gene was introduced by injecting liposomes directly into the patients’ bodies.b. Lymphocytes were removed from a SCID patient, the normal ADA gene was transferred
Is each of the following a method used in linkage, cytogenetic, or physical mapping?A. Fluorescence in situ hybridization (FISH)B. Conducting two-factor crosses to compute map distances C. Chromosome walking D. Examination of polytene chromosomes in Drosophila E. Use of RFLPs in crosses F.
In a fluorescence in situ hybridization (FISH) experiment, what is the relationship between the base sequence of the probe DNA and the site on the chromosomal DNA where the probe binds?
A woman had five children with two different men. This group of seven individuals is analyzed with regard to three different STSs:STS-1 is 146 bp and 122 bp; STS-2 is 102 bp and 88 bp; and STS-3 is 188 bp and 204 bp. The mother is homozygous for all three STSs: STS-1 = 122, STS-2 = 88, and STS-3 =
Place the following stages of a physical mapping study in their most logical order:A. Clone large fragments of DNA to make a BAC library.B. Determine the DNA sequence of subclones from a cosmid library.C. Subclone BAC fragments to make a cosmid library.D. Subclone cosmid fragments for DNA
What is meant by sequencing by synthesis?
A DNA microarray is a slide that is dotted witha. mRNAs from a sample of cells.b. fluorescently labeled cDNAs.c. known sequences of DNA.d. known cellular proteins.
The purpose of a ChIP-chip assay is to determinea. the expression levels of particular genes in a genome.b. the sites in a genome where a particular protein binds.c. the amount of a specific protein that is made in a given cell type.d. any of the above.
For the method of RNA sequencing (RNA-Seq), which of the following is the correct order of steps?a. Isolate RNAs, synthesize cDNAs, fragment RNAs, sequence cDNAs, align cDNA sequencesb. Synthesize cDNAs, sequence cDNAs, isolate RNAs, fragment RNAs, align cDNA sequencesc. Isolate RNAs, fragment
A gene knockout is a genea. whose function has been inactivated.b. that has been transferred to a different species.c. that has been moved to a new location in the genome.d. that has been eliminated from a species during evolution.
Which of the following is a reason why the proteome of a eukaryotic cell is usually much larger than its genome?a. Alternative splicingb. RNA editingc. Posttranslational covalent modificationsd. All of the above are reasons for the larger size of a proteome.
During two-dimensional gel electrophoresis, proteins are separated based ona. their net charge at a given pH.b. their mass.c. their ability to bind to a specific resin.d. both a and b.
The technique of tandem mass spectrometry is used to determinea. the amino acid sequence of a peptide fragment.b. the nucleotide sequence of a segment of RNA.c. the nucleotide sequence of a segment of DNA.d. the number of genes in a species’ genome.
Which of the following can be analyzed using a protein microarray?a. The amounts of particular proteins made by a sample of cellsb. Protein functionc. Protein-protein interactionsd. All of the above
The identification of a stop codon for a particular gene is an example ofa. sequence recognition.b. pattern recognition.c. both a and b.d. none of the above.
Homologous genesa. are derived from the same ancestral gene.b. are likely to carry out the same or similar functions.c. have similar DNA sequences.d. exhibit all of the above features.
The BLAST program begins with a particular genetic sequence anda. translates it into an amino acid sequence.b. determines if it contains one or more genes.c. identifies homologs within a database.d. does all of the above.
What type of chromosome mapping relies on microscopy?a. Cytogenetic mappingb. Linkage mappingc. Physical mappingd. All of the above rely on microscopy.
The technique of fluorescence in situ hybridization involves the use of a ___________ that hybridizes to a ____________.a. radiolabeled probe, band on a gelb. radiolabeled probe, specific site on an intact chromosomec. fluorescent probe, band on a geld. fluorescent probe, specific site on an intact
A molecular marker is a ______________ that is found at a specific site on a chromosome and has properties that allow it to be ___________.a. colored dye, visualized via microscopyb. colored dye, visualized on a gelc. segment of DNA, uniquely identified using molecular toolsd. segment of DNA,
Which of the following is an example of a molecular marker?a. RFLPb. Microsatellitec. Single-nucleotide polymorphismd. All of the above are types of molecular markers.
To map the distance between molecular markers via testcrosses, the markers must bea. polymorphic.b. monomorphic.c. fluorescently labeled.d. on different chromosomes.
What is a contig?a. A fragment of DNA that has been inserted into a vectorb. A series of vectors that contain inserts that have overlapping regions of chromosomal DNAc. A method of identifying a disease-causing alleled. A method of sequencing DNA
A vector that can carry a large fragment of chromosomal DNA is aa. YAC.b. BAC.c. PAC.d. Any of the above can carry a large fragment of chromosomal DNA.
Chromosome walking is a method of ______________ in which a researcher begins at a specific site on a chromosome and analyzes __________________ until the gene of interest is reached.a. DNA sequencing, a series of subclonesb. positional cloning, a series of subclonesc. DNA sequencing, bands on a
Shotgun sequencing is a method of DNA sequencing in whicha. the DNA fragments to be sequenced are randomly generated from larger DNA fragments.b. the sequencing reactions are carried out in rapid succession.c. the samples to be sequenced are rapidly generated by PCR.d. all of the above occur.
Which of the following was not a goal of the Human Genome Project?a. To obtain the DNA sequence of the entire human genomeb. To successfully clone a mammalc. To develop technology for the management of human genome informationd. To analyze the genomes of model organisms
A prokaryotic genome is about 4 million bp in length. About how many genes would you expect it to contain?a. 400b. 4000c. 40,000d. 400,000
Metagenomics is aimed ata. determining the complete genome sequence of newly identified microorganisms.b. mapping the genes on chromosomes of newly identified microorganisms.c. determining the sequence of DNA fragments in environmental samples.d. determining the functions of all of the genes in a
What is the functional significance of sticky ends in a gene cloning experiment? What type of bonding makes the ends sticky?
Describe the important features of cloning vectors. Explain the purpose of selectable markers in cloning experiments.
In your own words, describe the series of steps necessary to clone a gene.
What phase of PCR (exponential, linear, or stationary) is analyzed to quantitate the amount of DNA or RNA in a sample? Explain why this phase is chosen.
DNA sequencing can help researchers identify mutations within genes. The following data are derived from an experiment in which a normal gene and a mutant gene have been sequenced:Locate and describe the mutation. G = Yellow A = Green T = Red C = Blue Normal Mutant
A sample of DNA was subjected to automated DNA sequencing and the output is shown here.G = BlackA = GreenT = RedC = BlueWhat is the sequence of this DNA segment?
A portion of the coding sequence of a cloned gene is shown here:5′–GCCCCCGATCTACATCATTACGGCGAT–3′3′–CGGGGGCTAGATGTAGTAATGCCGCTA–5′This portion of the gene encodes a polypeptide with the amino acid sequence alanine–proline–aspartic
Northern blotting depends on the phenomenon of the binding of a labeled DNA segment to an mRNA. Explain why this binding occurs.
In Northern and Western blotting, what is the purpose of gel electrophoresis?
If you wanted to know if a protein was made during a particular stage of development, what technique would you choose?
Describe the rationale underlying the technique of an electrophoretic mobility shift assay.
An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the results shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase II (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of
Explain the rationale underlying a DNase I footprinting experiment.
Which of the following uses of microorganisms is/are important to humans?a. Production of medicinesb. Food fermentationc. Biological controld. All of the above are important to humans.
What is the key reason why the A and B chains of insulin are made as fusion proteins with β-galactosidase?a. To make purification easierb. To prevent their degradationc. To be secreted from the celld. All of the above are reasons for making the chains as fusion proteins.
Which of the following was the first living organism to be patented?a. A strain of E. coli that makes somatostatinb. A strain of E. coli that makes insulinc. An oil-eating bacteriumd. A strain of B. thuringiensis that makes an insecticide
Showing 100 - 200
of 1426
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Step by Step Answers