Question: Below is a short nucleotide sequence from a gene. Use a computer program from the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence

Below is a short nucleotide sequence from a gene. Use a computer program from the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found.

5′–GGGCGCAATTACTTAACGCCTCGATTATCTTC TTGCGCCACTGATCATTA–3′

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Structural Analysis Questions!

Use transformations to explain how the graph off can be found by using the graph of y = x 2 , y = x, or y = |x|. You do not need to graph y = f(x). f(x) = (x + 2) - 3

An election with three candidates has the following rankings: a. Is there a majority? If not, who wins the plurality vote? b. Who wins using the Borda count method? c. Does the Borda method violate...

Image transcription text Module 5 Discussion A' Instructions: This discussion will be completed in two parts, and will give you an opportunity to reect upon this week's content and to interact with...

LearningObjectives Working with strings in Python Basic functions in Python Working with GenBank Understanding nucleotide composition in DNA Strings in GenBank Access GenBank...

You have been hired by a genome lab to write a java program that will read in information from a text file and produce specific results to the screen and an output file. Concepts Arrays of objects...

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txt and ecoli.txt from below. Save these files in the same folder...

I have to create a program in C and I can't figure it out. The program has to read a source file. Please help. /******************************************************************** PROJECT: Glossary...

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

In a balanced three-phase wye-wye system, the source is 20 + j1. The source has an abc-phase sequence and V an = 120

A production supervisor at a major chemical company wishes to determine whether a new catalyst, catalyst XA-100, increases the mean hourly yield of a chemical process beyond the current mean hourly...

let y = ( x ^ 2 + x - 9 ) / ( x ^ 3 + 4 ) . Use the quotient rule to find y '

4. Give an example of each kind of risk: personal, property, and liability.

The following compound can react rapidly via an S N 1 process. Explain why this primary substrate will undergo an S N 1 reaction so rapidly. OTs

In Chapter 9, we learned about addition of water across a Ï bond. Identify whether the alkene has been oxidized, reduced, or neither. (First look at each carbon atom separately, and then look at...

Sigma bonds experience free rotation at room temperature: In contrast, Ï bonds do not experience free rotation. Explain. . cec - `H

Checking Account Reconciliation Statement date: September 16, 2017 Statement balance (Enter balance from statement): $2,498 Step 1: Subtract total of outstanding checks (checks that you have written...

Hello, I need some help with the adjusted trial balance for this question for this accounting assignment. Please show work! Thank you! Required information Exercise 8-19 (Algo) Complete the...

Wrong answers will be downvoted and reported. Suppose that your firm manufactures rubber chickens. Monthly demand for the chickens is 3 3 , 0 0 0 units. Setup cost per order is $ 8 5 , and the annual...