A portion of the coding sequence of a cloned gene is shown here:

5′–GCCCCCGATCTACATCATTACGGCGAT–3′

3′–CGGGGGCTAGATGTAGTAATGCCGCTA–5′

This portion of the gene encodes a polypeptide with the amino acid sequence alanine–proline–aspartic acid–leucine–histidine–

histidine–tyrosine–glycine–aspartic acid. Using the method of site-directed mutagenesis, a researcher wants to change the leucine codon to an arginine codon, using an oligonucleotide that is 19 nucleotides long. What is the sequence of the oligonucleotide that should be used? Designate the 5′ and 3′

ends of the oligonucleotide in your answer. The mismatch should be in the middle of the oligonucleotide, and a 1-base-pair mismatch is preferable to a 2- or 3-base-pair mismatch. Use the bottom strand as the template strand for this site-directed mutagenesis experiment.